using a separate data receiver thread

Tài liệu Module 3: Using a Conceptual Design for Data Requirements docx

Tài liệu Module 3: Using a Conceptual Design for Data Requirements docx

... the solution’s overall data design If a solution has no data requirements, it has no need for data storage, let alone a logical data organization Determining the functional data requirements from ... to perform a function or task Each functional data requirement is directly traceable to an actor and an object within a use case Nonfunctional data requirements A nonfunctional data requirement ... The logical and physical implementation of a database necessitates that the data requirements be defined What types of data (at a high level) are going to be stored? " Explicit The data requirements...

Ngày tải lên: 10/12/2013, 17:15

20 581 0
Tài liệu Modifying Data Using a Strongly Typed DataSet pptx

Tài liệu Modifying Data Using a Strongly Typed DataSet pptx

... modification to the database sqlDataAdapter1.Update(myDataTable); // display the DataRow objects in myDataTable // in the listView1 object foreach (MyDataSet.CustomersRow myDataRow2 in myDataTable.Rows) ... method myDataTable.AddCustomersRow(myDataRow); // push the new row to the database using // the Update() method of sqlDataAdapter1 sqlDataAdapter1.Update(myDataTable); // find the row using the ... method of myDataTable myDataRow = myDataTable.FindByCustomerID("J5COM"); // modify the CompanyName and Address of myDataRow myDataRow.CompanyName = "Widgets Inc."; myDataRow.Address = "1 Any Street";...

Ngày tải lên: 24/12/2013, 01:17

3 300 0
Tài liệu Updating Server Data Using a Web Service pptx

Tài liệu Updating Server Data Using a Web Service pptx

... UpdateOrders(DataSet ds) { // Create the DataAdapters for order and order details tables SqlDataAdapter daOrders = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["DataConnectString"]); ... ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); da.FillSchema(orderDetailTable, SchemaType.Source); da.Fill(orderDetailTable); ds.Tables.Add(orderDetailTable); ... ORDERS_ORDERDETAILS_RELATION = "Order_OrderDetails_Relation"; // [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet...

Ngày tải lên: 24/12/2013, 05:15

6 415 0
Tài liệu Instructor Notes Module 3: Using a Conceptual Design for Data Requirements pdf

Tài liệu Instructor Notes Module 3: Using a Conceptual Design for Data Requirements pdf

... Module 3: Using a Conceptual Design for Data Requirements Activities Activity 3.1: Identifying Data- Related Use Cases and Data Requirements In this activity, students will determine data requirements, ... be able to: • Discuss use cases, data requirements, and requirements validation as they relate to conceptual design for data systems ! To prepare for the activity • Review the activity and anticipate ... Many students with database backgrounds will want to think and work in the physical data model Remind them that, at this point, the work is still in the conceptual phase THIS PAGE INTENTIONALLY...

Ngày tải lên: 17/01/2014, 09:20

4 448 0
Tài liệu Báo cáo khoa học: "Updating a Name Tagger Using Contemporary Unlabeled Data" ppt

Tài liệu Báo cáo khoa học: "Updating a Name Tagger Using Contemporary Unlabeled Data" ppt

... de entidades mencionadas em portuguˆ s: Documentacao e actas HAREM, a e ¸˜ primeira avaliacao conjunta na area Linguateca, ¸˜ ´ 12 de Novembro Fernando Batista, Nuno Mamede, and Isabel Trancoso ... Actas V Encontro para o processamento computacional da l´ngua portuguesa ı escrita e falada PROPOR 2000, pages 131–140, Atibaia, S˜ o Paulo, Brasil a Diana Santos and Nuno Cardoso, editors 2007 ... performance than using increasing sizes of older unlabeled data These results suggest that we may not need to label new data nor train our tagger with increasing sizes of data, as long as we are able...

Ngày tải lên: 20/02/2014, 09:20

4 329 0
Báo cáo khoa hoc:" Estimating covariance functions for longitudinal data using a random regression model" potx

Báo cáo khoa hoc:" Estimating covariance functions for longitudinal data using a random regression model" potx

... recognized as a suitable alternative to the conventional multivariate mixed model to describe genetic and phenotypic variation for longitudinal data, i.e typically data with many, ’repeated’ measurements ... ’infinite-dimensional’ equivalent to covariance matrices in a traditional, ’finite’ multivariate analysis [15] As the name indicates, a covariance function (CF) describes the covariance between records taken at ... regression on maternal phenotype as well as additive genetic and environmental components of variance Alternatively, estimation may be carried out in a Baysian framework using a Monte Carlo based technique,...

Ngày tải lên: 09/08/2014, 18:21

20 218 0
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT GTAGATTTATAGAGAAACAACCCTGTAAATCCGGTGAT GTAGATTTATAGAGAAACAACCCTGTAAATCCGGTGAT ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA...

Ngày tải lên: 12/08/2014, 03:20

10 252 0
Báo cáo sinh học: " The analysis of disease biomarker data using a mixed hidden Markov model (Open Access publication)" ppt

Báo cáo sinh học: " The analysis of disease biomarker data using a mixed hidden Markov model (Open Access publication)" ppt

... HMM was assessed on simulated data based on parameters obtained in a survey of clinical mastitis cases Bayesian estimates of the parameters were obtained using the Gibbs sampler Finally, limitations ... bulls, each cow was replaced by a daughter and mating was at random Breeding values for base animals were sampled from a normal distribution with null mean and additive variance of 0.15 or 0.25 Values ... replicated 10 times Simulated rather than real data were used because a negative diagnosis, even based on the absence of bacteria in cell culture, is not a guarantee of health and the opposite has...

Ngày tải lên: 14/08/2014, 13:21

19 390 0
Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "

Báo cáo y học: "Prevention of Pleural Adhesions Using a Membrane Containing Polyethylene Glycol "

... Figure Macroscopic images of the rats A: Appearance of the visceral pleura after abrasion with dry and iodinated spanch B: Placement of a x cm anti-adhesion membrane (Prevadh®) in the adhesion ... findings are also based on the result of macroscopic and histopathological examinations However, biochemical data would elucidate physiopathological changes associated with pleural adhesion and the ... thoracotomy by using a hyaluronate-based absorbable membran in rats [6] Also, Getman et al achieved the same effect by using haemostatic membrane [7] The present study investigates the efficacy...

Ngày tải lên: 25/10/2012, 11:00

7 456 0
Natural botanical products have a long history in the world and are featured in using a complex

Natural botanical products have a long history in the world and are featured in using a complex

... intratumoral injection of "Star-99" in treatment of hepatocellular carcinoma of nude mice World J Gastroenterol 2003, 9: 701-5 Nandakumar KS, Lakshmi Rao K, Pardhasaradhi BV, Khar A Upregulation of antitumor ... Yasukawa K, Ikeya Y, Mitsuhashi H, Iwasaki M, Aburada M, Nakagawa S, Takeuchi M, Takido M Gomisin A inhibits tumor promotion by 12-O-tetradecanoylphorbol-13acetate in two-stage carcinogenesis in ... treatment groups was analyzed using a two-way statistical analysis of variance (ANOVA), followed by Dunnett t-test and post-hoc analysis when necessary Results Effect of CKBM treatment on gastric tumor...

Ngày tải lên: 03/11/2012, 09:54

9 713 0
 Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

Báo cáo y học: "Discriminating between elderly and young using a fractal dimension analysis of centre of pressure"

... from a fractal pattern may be indicative of a shift towards an unhealthy or less desirable control strategy The analysis of fractal patterns in gait and posture data may serve as an indicator ... Parkinsonian patients (PP), spinocerebellar ataxia (SCA) patients, and healthy participants’ COP were analysed using a more traditional fractal dimension analysis [13] This method recorded COP data and ... data were obtained using a k-max value of 60 for A/ P analysis and 30 for M/L analysis (cf [17]) The fractal dimension was calculated over the entire two minute epoch using all data points Traditional...

Ngày tải lên: 03/11/2012, 10:09

10 460 0
Estimation of Proper Strain Rate in the CRSC Test Using a Artificial Neural Networks

Estimation of Proper Strain Rate in the CRSC Test Using a Artificial Neural Networks

... from the field data In particular, these differences are increase at the high strain rate range The reason is that ANN model has not a lot of database on the high strain rate To eliminate this effect ... realize complex mapping In order to verify the applicability of MANN model, a total of 46 data of the consolidation test results are used 43 learning data are used for training the ANN model, and ... OF STRAIN RATE r= V − Vmin Vmax − Vmin Data Collection Data Normalization Parametric Studies (3) Training and Testing ANN in which LI is the liquidity index with soil saturated, Pa is the atmospheric...

Ngày tải lên: 22/03/2013, 15:01

5 520 1
STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING a PROJECT MANAGEMENT

STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING a PROJECT MANAGEMENT

... critical success factors: qualitative factors, organizational factors, and quantitative factors To take advantage of the economic outlook, whatever it happened to be at a given time, senior managers ... Responsibility Evaluation of Information Managerial Values of Management Strategy Evaluation Strategy Selection Strategy Implementation FIGURE 2–1 Basic strategic planning Corporate Strategic Plan Strategic ... 9:42 AM Page 5 Gap Analysis fected by the organization’s performance, but may even have a claim on its performance As an example, unions can have a strong influence on how a project management...

Ngày tải lên: 14/08/2013, 13:47

271 631 2
Research on MAP Recovery Conditions using a Fluidized-bed Crystallized Phosphorous Removal System

Research on MAP Recovery Conditions using a Fluidized-bed Crystallized Phosphorous Removal System

... phosphorus load (kg-P/d), VMAP is Volume of MAP particle layer (m3), SMAP is Overall MAP surface of MAP particle layer (m2) Overall MAP surface was calculated using the following assumption a) MAP particles ... apparatus was made by adding magnesium and adjusting the pH, and new MAP was made to form on the surface of the MAP particles already in the reactor The interior of the reactor was aerated using air ... mm), and a treated water tank Raw water NaOH Treated water The raw water and part of the treated water in the treated water tank was made to flow upward Treated water tank (LV: 60 m/hr) from the...

Ngày tải lên: 05/09/2013, 08:40

6 439 0
A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor

A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor

... Rajakumar, R and Meenambal, T [3] to investigate the performance for each hybrid UASB reactor and anaerobic filter (AF) reactor, where the comparison of this study was mainly compared the start-up ... to be transferred to the analysis laboratory for parameters analysis The related parameters were observed and analyzed daily are Chemical Oxygen Demand (COD), Total Nitrogen (TN), Total Phosphorus ... Habeeb, S A. , AB Aziz Bin Abdul Latiff., Zawawi Bin Daud., Zulkifli Bin Ahmad A review on granules initiation and development inside UASB Reactor and the main factors affecting granules formation process...

Ngày tải lên: 05/09/2013, 16:11

8 411 0
Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model

Estimation of emissions of nonmethane organic compounds from a closed landfill site using a landfill gas emission model

... show the minimum and maximum annual average acceptance rates to be 999.2 mg/year and 1000.8 mg/year respectively The mean, variance, and standard deviation are 1000 mg/year, 0.0504, and 0.225 respectively ... generation rate, k and potential methane generation capacity, Lo Emission type Landfill type CAA Conventional CAA Arid area Inventory Conventional Inventory Arid area Inventory Wet (bioreactor) Source: ... dioxide are the major gases produced by biodegradation of landfill wastes [2-4, 7] According to Scheutz et al [2], the biodegradable organic material in waste includes paper, animal and vegetable matter,...

Ngày tải lên: 05/09/2013, 16:11

8 542 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

... pp.927-938 935 (a) Best, mean and median objective valuses for Case I (b) Standard deviations for Case I (c) Best, mean and median objective values for Case II (d) Standard deviations for Case II Figure ... Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, the size of the farm is ... William Palm Professor of Engineering in department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail...

Ngày tải lên: 05/09/2013, 17:03

12 636 1
Measuring Word Recognition Using a Picture

Measuring Word Recognition Using a Picture

... "Look at the picture (Pause) Look at the words around the picture (Pause.) Find the biggest word What is that word? (Students will say, "Table.") A line has been drawn from that word to the TABLE ... specifications above utilize the format that appears in Lynch and Davidson (1994), "Criterion-referenced language test development: Linking curricular, teachers, and tests." TESOL Quarterly 28(4), ... (e.g., chairs), any line drawn to the corresponding objects will be treated as correct Specifications Supplement • Testers can use this task type as one of a multiple of task types in a reading...

Ngày tải lên: 06/09/2013, 11:10

3 324 1
w