... differences with respect to the first draft are calculated for both post -test and delayed post -test Also, the differences between the delayed post -test and the post -test are calculated as well A sample ... for the present study include first draft, second draft, post -test, and delayed post -test The first draft was written on the first day of the experiment, and the second draft was written on the ... fourth day The post -test was conducted on the eighth day; and the delayed post -test was conducted months later The research design of the study incorporated thinkaloud methodology The think-aloud...
Ngày tải lên: 30/09/2015, 10:11
... was at the bottom of the table Table IV shows high and positive correlations in the assessment of male and female esthetics Correlation in evaluation o female esthetics was important only between ... patient´s perceptions Orthodontists and clinicians must take into account the subjective response of the patient to what he considers an esthetic profile This information can ease information among ... self-perception is an important factor for seeking orthodontic treatment.4-7 This is the main reason driving adults to seek treatment.8,9 The strongest motivation for adults subjected to orthognathic...
Ngày tải lên: 19/02/2014, 17:20
English Language Tests-Intermediate level''''s archiveReal Life: Types of Buildings (3) ppt
... a large place that usually has a big building and several runways on it Airplanes fly into and out of these places on a regular basis airport train station ski lodge pyramid 9 .A is a large ... attend classes in order to get a post-secondary education pyramid university shopping mall warehouse 5 .A is a building that houses ancient and historical artifacts and other items of interest These ... they die graveyard concert hall restaurant mill 7 .A is a very tall, large building that is found in large cities It usually has many floors skyscraper art gallery factory stadium 8.An is a...
Ngày tải lên: 25/07/2014, 07:20
báo cáo khoa học: " ''''Who''''s who'''' in two different flower types of Calluna vulgaris (Ericaceae): morphological and molecular analyses of flower organ identity" pdf
... Forward: TCGACGAGCTGAATAGTCTTGA Reverse: TCGACTAGCCCATAGTGTGGAT 190 CvSEP1 [GenBank:GQ202027] forward: AGCATCATCCTCAATCCCAG Reverse: GATCATTCCGCTCACGTTTT 143 Page 12 of 15 (page number not for ... of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-DDCT Method Methods 2001, 25:402-408 Pfaffl MW: Quantification strategies in real-time PCR In A- Z of quantitative PCR ... uncertainties still exist on the topic of the flower organ identity in this species On the one hand, questions arise regarding the discrete identity of the two outer whorls of colored organs On the...
Ngày tải lên: 12/08/2014, 03:21
The graphs below show the types of music albums purchased by people in Britain according
Ngày tải lên: 04/10/2012, 10:02
Bơm ECD-V - P - Types of Systems in ECD-V Series
... operating conditions of the engine and the driving conditions Then, the engine ECU calculates the fuel injection volume and the injection timing that are necessary for operating the engine in an ... an optimal state, and actuates the valves The control system can be broadly classified by their electrical components into the following three systems: Sensor system, ECU, and Actuator system ... combustion into the cylinders, consists of the areas from the fuel tank to the injection pump and the nozzles Control system This system, which controls the fuel injection volume and injection timing,...
Ngày tải lên: 23/10/2012, 09:09
Báo cáo y học: " Introducing the Critical Care Forum’s ongoing review of medical statistics"
... discipline in its own right and a medical statistician fully achieves that role only after years of training and practical experience Most academic departments, and also many clinical departments, include ... qualified medical statisticians and they should be consulted as early as possible in the research process Competing interests None declared References Altman DG: Practical Statistics for Medical ... sufficient and it is vital that researchers recognise their own limitations and seek professional advice whenever it is needed, if only for reassurance Medical statistics is a scientific discipline...
Ngày tải lên: 25/10/2012, 10:45
Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers
... what it is that the participants are expecting the language to for them in that situation, the symbolic organisation of the text, the status that it has, and its function in the context, including ... EPITHESIS and QUALIFICATION, interpersonal systems of PERSON and ATTITUDE, and textual systems of DETERMINATION But the way the metafunctional contributions map structurally one onto another varies; ... it is the characteristics of this situation type that influence the forms of language that realize the genre So the context of situation (register) is the second aspect of social context that...
Ngày tải lên: 07/11/2012, 14:44
An investigation into some types of verbal responses to questions in English and Vietnamese conversation
... to cue the respondent as to the appropriate nature of the speech act realization The DCT allows to elicitation of data from a large sample of subjects relatively easily, using the same situations ... different speakers and are related to each other in such a way they form a pair type They call them an adjacency pair The adjacency pair always consists of a first part and a second part The utterance ... Introduction establishes the rationale of the study, the aims, and the scope of the study; the research questions and organization of the study Part B: Contents consists of four chapters Chapter one...
Ngày tải lên: 07/11/2012, 14:54
NTC's pocket dictionary of words and phrases part 75
... used as the past tense of will to express the future from a time in the past, especially in indirect quotations or in constructions where other pasttense verbs are used (Contraction: -’d.) aux a ... of the wrong side of the bed → get up on the wrong side of the bed → in the wrong → in the wrong place at the wrong time → on the wrong track → rub someone’s fur the wrong way → rub someone the ... the land that surrounds a house or other dwelling yardstick ["jard stIk] n a ruler that is 36 inches—that is, one yard—long n something that other things are compared with; a standard (Figurative...
Ngày tải lên: 19/08/2013, 09:17
CO2e emissions from HVAC equipment and lifetime operation for common U.S. building types
... information on the economical transaction of materials and manufactured goods to estimate the total emissions of a particular sector due to those activities Using an estimated monetary amount spent ... Eastern Interconnection encompasses the vast area from the area east of the Rocky Mountains to the Atlantic coast of the United States, including some parts of Texas The Western Interconnection ... locations used in this study [17] Number Climate Zone Representative City TMY2 Weather Location 1A Miami, FL Miami, FL 2A Houston, TX Houston, TX 2B Phoenix, AZ Phoenix, AZ 3A Atlanta, GA Atlanta,...
Ngày tải lên: 05/09/2013, 15:28
Types Of Interviews
... • Conversational interview These are most closely related to the traditional style of interviewing They appear to be in a more comfortable, relaxed setting but not be fooled, these meetings are ... still in a professional environment and applicants should conduct themselves accordingly Casually asking about the interviewer’s hockey puck on his desk is okay but describing the wacky events ... interviewer’s hockey puck on his desk is okay but describing the wacky events at the last game you attended, is not ...
Ngày tải lên: 17/10/2013, 01:15
Take Care of Error Handling with Bound Controls
... Perform the requested task at the dataset ' level using the data adapter odaCustomerIndividual.Update(dsCustomerIndividual, "Customers") '- By accepting the changes, the data gets sent back to the ... next The Try statement is used to wrap the code that performs deletion of the data The code then uses a Catch statement to check whether the exception that occurs is a specific OleDbException, ... Perform the requested task at the dataset ' level using the data adapter odaCustomerIndividual.Update(dsCustomerIndividual, "Customers") '- By accepting the changes, the data gets sent back to the...
Ngày tải lên: 28/10/2013, 19:15
Tài liệu KRONE - the effect of Errors in TCP applications performance (full) pdf
... there is outgoing data, it will "piggy-back" its data on the packet that acts as the acknowledgement In the illustration in the figure above, there is no data to return from Station B So Station ... data If the target B wishes to continue to establish the connection, it will return a TCP segment with a header that has these characteristics: · It contains its ISN · The acknowledgement value ... result shown below The calculated BCC is inserted in the checksum field in the data packet and transmitted to the receiving station Character Character Character Character Character Character Character...
Ngày tải lên: 09/12/2013, 16:15