... Generally speaking, the activities for software quality assessment can be divided into two broad categories, namely, static analysis and dynamic analysis Static Analysis: As the term ―static‖ ... analyses, practitioners want to identify as many faults as possible so that those faults are fixed at an early stage of the software development Static analysis and dynamic analysis are complementary ... necessarily the final level of testing For example, a systematical integration testing in a large scope can be made after acceptance testing performed for a system Contract and regulation acceptance
Ngày tải lên: 23/09/2020, 21:09
... Trang 1R E S E A R C H A R T I C L E Open AccessDDmap: a MATLAB package for the double digest problem using multiple genetic operators Licheng Wang1 , Jingwen Suo1, Yun Pan2*and Lixiang Li1 Abstract ... such as GAATTC, on the DNA Double digest experiments (DDE for short) are a standard approach for constructing physical DNA maps [2] Given two restric-tion enzymes, denoted by A and B, this approach ... 100024, China Full list of author information is available at the end of the article Trang 2Table 1 Main results: separated and integrated effects of all six genetic operators Instance 1,3,4,5,7,8
Ngày tải lên: 25/11/2020, 12:23
CEMiTool: A Bioconductor package for performing comprehensive modular coexpression analyses
... Bürger1, Raul Arias-Carrasco2, Sandra R Maruyama3, Thiago D C Hirata1, Diógenes S Lima1, Fernando M Passos1, Kiyoshi F Fukutani3, Melissa Lever1, João S Silva3, Vinicius Maracaja-Coutinho2and Helder ... [5] Although tutorials and examples are available for using the package, following its workflow verbatim is time-consuming and tiresome Moreover, users are often required to manually select parameters ... compare CEMiTool to two R packages: WGCNA and Petal [10] Trang 3CEMiTool was run using its default parameters and alloptional files After filtering, the analyses were performed on 2129 genes for
Ngày tải lên: 25/11/2020, 15:10
Development of a software package for 3D structured mesh generation
... inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5,6f. For short, the formulae for Iand Z coordinates are the same and they are not ... used as the input of a 3D computational fluid dynamics software for turbulent compressible atrnospheric flows and air quality simulations 4.1 The graphic user interface of the package The package ... This software package has already been in practical use in some research in the Institute of Mechanics, VAST [4]. Email: ntthang@imech.ac.vn 93 Trang 294 D.N Hai, N.T Thang / VNU Journal of Science,
Ngày tải lên: 24/01/2021, 18:24
A Stata package for the estimation of the dose–response function through adjustment for the generalized propensity score.
... categorical covariate 3 The problem is whether the treatment variable takes zero value In such a case, the program continues, forcing a transformation of the treatment variable to take a suitable ... Stata that are of interest to intermediate or advanced users of Stata; 3) papers that discuss new commands orStata programs of interest either to a wide spectrum of users (e.g., in data management ... requires thatcategorical variables are expanded into indicator (also called dummy) variable setsand that one dummy-variable set is dropped in estimating the GPS However, thebalancing test should also
Ngày tải lên: 04/04/2021, 11:44
Joint Committee to Develop a Master Plan for Education – Kindergarten through University Master Plan for Education in California May 2002 Draft
... is appropriate that attendance in kindergarten be made mandatory for allchildren, noting that private and home-study kindergarten programs are appropriate alternatives to state-operated and classroom-based ... Second Annual Report Sacramento, CA. Trang 17California’s many ambitious reforms of recent years have had a significant impact on theprofessional development needs of California’s teaching workforce ... grade.Faculty within schools of education are essential to state efforts to ensure that all teachers andfaculty have not only academic expertise in at least one academic area but also a broad
Ngày tải lên: 18/10/2022, 19:08
coherency identification of generators using a pam algorithm for dynamic reduction of power systems
... generators are expected to have similar dynamic characteristics and responses during severe disturbance, such as a fault sequence Generators satisfying Equation (1) are then aggregated and replaced ... generators in each group can be aggregated and replaced by an equivalent generator, while preserving the dynamic characteristics of the original system with high accuracy 2.3 Generator Aggregation ... group Therefore, if generator information (such as bus connections and control systems) is available, the calculations can be reduced by choosing the initial generator set using this information The
Ngày tải lên: 01/11/2022, 09:06
opening the conformation is a master switch for the dual localization and phosphatase activity of pten
... Trang 1Opening the conformation is a master switch for the dual localization and phosphatase activity of PTEN Hoai-Nghia Nguyen, Jr-Ming Yang, Takafumi Miyamoto, Kie Itoh, Elmer Rho, Qiang Zhang, ... predominantly associated with the plasma membrane due to a higher affinity for the membrane22 To dissociate PTENA4 and ePTEN from the plasma membrane, we introduced a cancer-associated mutation, ... the tail domain A mutant PTEN (PTENA4), in which these phosphorylation sites are substituted with alanines, is maintained in an open confor-mation and targeted to both the plasma membrane and
Ngày tải lên: 04/12/2022, 16:02
Luận văn an eficient method for automated control flow testing of programs
... dɣпamiເ aпalɣses, ρгaເƚiƚi0пeгs waпƚ ƚ0 ideпƚifɣ as maпɣ faulƚs as ρ0ssiьle s0 ƚҺaƚ ƚҺ0se faulƚs aгe fiхed aƚ aп eaгlɣ sƚaǥe 0f ƚҺe s0fƚwaгe deѵel0ρmeпƚ Sƚaƚiເ aпalɣsis aпd dɣпamiເ aпalɣsis aгe ... s0fƚwaгe qualiƚɣ assessmeпƚ ເaп ьe diѵided iпƚ0 ƚw0 ьг0ad ເaƚeǥ0гies, пamelɣ, sƚaƚiເ aпalɣsis aпd dɣпamiເ aпalɣsis Sƚaƚiເ Aпalɣsis: As ƚҺe ƚeгm ―sƚaƚiເ‖ suǥǥesƚs, iƚ is ьased 0п ƚҺe eхamiпaƚi0п ... 0ρƚimizaƚi0пs aгe sƚaпdaгd sƚaƚiເ aпalɣsis Dɣпamiເ Aпalɣsis: Dɣпamiເ aпalɣsis 0f a s0fƚwaгe sɣsƚem iпѵ0lѵes Luận văn thạc sĩ luận văn cao học luận văn 123docz Trang 197 aເƚual ρг0ǥгam eхeເuƚi0п
Ngày tải lên: 12/07/2023, 13:12
The use of labour flexibility for output control in workload controlled flow shops: A simulation analysis
... flexibility for output control in workload controlled flow shops: A simulation analysis Alberto Portioli-Staudacher a , Federica Costa a* and Matthias Thürer b a Department of Management, Economics and ... (Hopp & Spearman 2001) Capacity flexibility has been a solution to align capacity and demand, because it provides managers the possibility of (re)allocating capacity, such as labour, according ... it is assumed that all jobs are accepted, materials are available, and all necessary information, e.g regarding shop floor routings and processing times, are known If order release is applied,
Ngày tải lên: 14/05/2020, 22:53
A new method for remediation of sandy slopes susceptible to seepage flow using EPS-block geofoam
... slope materials, weak foundation conditions, and earthquakes are major factors affecting slope instability Seepage is another primary cause of slope instability for both manmade and natural slopes ... Trang 1A new method for remediation of sandy slopes susceptible to seepageflow using EPS-block geofoam A Tolga Özera,*, Onur Akaya, Garey A Foxb, Steven F Bartlettc, David Arellanod a Department ... angle of the sand and the apparent interface adhesion, ca, is zero.Xenaki and Athanasopoulos (2001) indicated that by increasing normal stress acting at the interface, the interaction behavior becomes
Ngày tải lên: 18/05/2021, 17:26
integrating-experiment-modeling-and-design-using-a-hands-on-hydraulic-positioning-laboratory-for-mechanical-control-systems-education
... Design using a Hands on Hydraulic Positioning Laboratory for Mechanical Control Systems Education Abstract As part of a laboratory intensive curriculum, Mechanical Engineering students at California ... at Cal Poly for eight years, where he designed and implemented a hydraulic/pneumatic servo system for graduate and undergraduate study He has a broad industrial background He has also taught for ... students to eliminate the constant valve internal leakage (included in the data) and account for the flow direction through the valve (not apparent at the flow meter) The adjusted data can then be plotted
Ngày tải lên: 30/10/2022, 21:05
Building a transgenic sexing strain for genetic control of the Australian sheep blow fly Lucilia cuprina using two lethal effectors
... dominant and cannot be repressed by maternal tetracycline DH6 females die at the late-larval stage Several fitness parameters important for mass rearing such as hatching rate, adult emergence and ... important for mass-rearing To evaluate the potential of the DH6 for mass-rearing in a factory, several fitness characteristics were measured and compared to the parental EF1#12 and FL3#2 strains and also ... decrease the advantage of a fertile re-lease program compared to releasing radiation steril-ized males For use in Australia, it would be desirable to backcross DH6 to a local strain of L cuprina for
Ngày tải lên: 30/01/2023, 20:08
Advanced control for constrained processes and systems a unified and practical approach
... manual-automatic or controller switching. The key aim of this book is to reduce the gap between the available constrained control literature and industrial applications. Trang 2Advanced Controlfor ... simultaneously controlpressure and temperature at several points of a reactor An automated greenhouseshould ensure that the lighting, relative humidity and temperature are adequate for agiven cultivation A ... physical limits that affect the achievableclosed-loop performance Particularly, it is well known that mechanical stops ortechnological actuator limitations give rise to unavoidable constraints at
Ngày tải lên: 04/10/2023, 15:53
design and control a hexacopter using fuzzy pid controller for an indoor ultra wide band localization system
... consumption Low Average Average High 9 Cost Low Average Average High From the comparison table, it can be seen that the Hexacopter has an advantage in average size and design, the amount of propellers ... center and supports a rotor, and the arrangement of these arms creates a symmetrical hexagonal pattern The hexagonal shape is formed by the even spacing of the arms and rotors around the central axis ... transmit a message to a tag and start time counter Step 5: UWB tag receives the message and transmit message back to anchor Step 6: UWB anchor receives the message again and calculate the total
Ngày tải lên: 01/10/2024, 10:31
Tài liệu Module 3: Using a Conceptual Design for Data Requirements docx
... reasons for gathering and analyzing data, as well as the formulation of this data into use cases Use cases will be the foundation for determining data requirements for the system Module 3: Using ... skills and experience necessary to perform a task • Collect artifacts, such as printed documentation and manuals 50 Module 3: Using a Conceptual Design for Data Requirements Analyzing Information ... important to superfluous Validation Information provided is not always accurate, so it is important for the team to validate the information gathered One method of validating information is to gather...
Ngày tải lên: 10/12/2013, 17:15
Báo cáo "Development of a software package for 3D structured mesh generation " pdf
... inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same and they are not ... generation for the computational domain surrounding a 3D sinusoidal object Another 3D object is assumed to have a sinusoidal shape A 3D computational mesh will be generated for a specific domain ... interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any 3D objects in the form of digitized...
Ngày tải lên: 14/03/2014, 13:20
A BlueprinT for suCCess - A MAster PlAn for econoMic redeveloPMent pot
... Initiate Capital Campaign Recommendation EDC should engage and retain a professional capital campaign solicitor to a five-year campaign engaging both the public and private sectors Approach Interview ... Coalition of Southwest Indiana Organizational The asset-based analysis also made specific organizational recommendations regarding staffing, budget, governance and other related items that allow ... observed by the advantage, Southwest Indiana Southwest Indiana has achieved take the lead in proposing state success in many areas but it can be a legislation for a sustainable economic great region...
Ngày tải lên: 17/03/2014, 06:20
A Monthly Struggle for Self-Control? Hyperbolic Discounting, Mental Accounting, and the Fall in Consumption Between Paydays ppt
... reasonable parameter values, the model can generate a decline that matches the data We assume δ = 1, which is reasonable over a week or a day, and an annual interest rate of r = 0.03 In the case ... 47-68 Ariely, Dan and Klaus Wertenbroch (2002) “Procrastination, Deadlines, and Performance: Self -Control by Precommitment,” Psychological Science, May, 13, 219-224 Ashraf, Nava, Dean S Karlan, and ... University of California, Berkeley, Manuscript DellaVigna, Stefano and M Daniele Paserman (2005) “Job-Search and Impatience,” Journal of Labor Economics, July Fang, Hanming and Daniel Silverman (2004)...
Ngày tải lên: 23/03/2014, 03:20
báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx
... SD2R1F TAGAATTCATCGCCACGACCATG SD2R1R TAGAATTCCGCGGTTCGGCAGA simX5D3F TAGAATTCTGTACAAGGCCTGGT DNA-shift assay PD3 simX5D3R simEXX4F TAGAATTCGCGACAGGAGCCATA TAGAATTCGACGCCTTCCAGTC DNA-shift assay PX4 ... CCAATTGCGCTACGCTCCT DNA-shift assay PSEx1 PEx1R simA7F CCATGTAGGCGGTGACGA TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay PA7 simA7R ATAAGCTTGTCGATACCGATCTTC DNA-shift assay PEx2 DNA-shift assay PSR3 PEx2F ACTTCCCAGAAGTA ... TAGAATTCTCAGAACATCGTCC SR2ExXF AAATCTAGATCAAGCCAGTGCTG DNA-shift assay PR2Ex SR2ExXR TTTGAATTCTTGACCACCACTTC DNA-shift assay PSR2 PSR2F TCGACGAGGTCCTCTTTG PSR2R TCGTATTCATACACCGTAC PEx1F CCAATTGCGCTACGCTCCT...
Ngày tải lên: 21/06/2014, 17:20