using a computerized video tracking system

Informing physicians using a situated decision support system: Disease management for the smart city

Informing physicians using a situated decision support system: Disease management for the smart city

... support system: Disease management for the smart city Raafat George Saade* John Molson School of Business Concordia University, Montreal, Canada E-mail: raafat.saade@concordia.ca Rustam Vahidov ... Functionality of clinical information systems have grown from rudimentary data entry and retrieval on an intra-hospital basis, to real-time data retrieval, multi-user data entry, multi-access data ... data entry and retrieval on an intra-hospital basis, to real-time data retrieval, multi-user data entry, multi-access data retrieval, knowledge sharing, sophisticated consultation, patient and

Ngày tải lên: 10/01/2020, 07:17

22 35 0
genome modifications and cloning using a conjugally transferable recombineering system

genome modifications and cloning using a conjugally transferable recombineering system

... TGGGGCAGTTGATGAAACATCGCGCAGCCTGCCGGCCCCACATGGCCTCGACAGCCGCTAGTAGACTTCCGTTGAACT Li-CatR CCCTTTTATTATCTACCCAAGATATATGGTAATCTGCAGAAATTATGCTAGGAATGCATGGCCTAATGAGTGAGCTAA O_2RecF T*C*T*G*AGCGTAATCCATAGTCAAACCAGAAATTTTAAATTTAAGGATGTTGAATTTTGTAGACTTCCGTTGAACT ... GTTCAAAAAATTCCCGATGGAATCAAATTAGGCAGTGGCAGGTGTCAAAACATATGAATATCCTCCTTAGT ML44-RedF ATGCTTACAACAAAAAATATGCCAGCCAATGCTGGGCTGGCAGCGTTTTCTGGTGTAGGCTGGAGCTGCTTC ML44-RedR TTAGCAAGGGGGAAGATGCTCTGGTGGTGATGGTCTGTTTTTCTGATGATAGCATATGAATATCCTCCTTAGT ... T*G*G*G*GCAGTTGATGAAACATCGCGCAGCCTGCCGGCCCCACATGGCCTCGACAGCCGCTAGTAGACTTCCGTTGAACT Ligase-catR C*C*C*T*TTTATTATCTACCCAAGATATATGGTAATCTGCAGAAATTATGCTAGGAATGCATGGCCTAATGAGTGAGCTAA Li-CatF TGGGGCAGTTGATGAAACATCGCGCAGCCTGCCGGCCCCACATGGCCTCGACAGCCGCTAGTAGACTTCCGTTGAACT

Ngày tải lên: 02/11/2022, 10:42

12 4 0
(Đồ án hcmute) research, design and fabrication of a sport performance tracking system

(Đồ án hcmute) research, design and fabrication of a sport performance tracking system

... and calibrated data in x-y axis Figure 4.4.3.b Comparison of raw data and calibrated data in y-z axis Figure 4.4.3.c Comparison of raw data and calibrated data in x-z axis The acceleration values ... infrared rays and capturing the reflected signals, allowing for accurate heart rate monitoring with each heartbeat.+ Usable for a wide variety of sports + Easy and comfortable to wear + Affordable ... wasn’t available anywhere a decade ago [27] The Global Positioning System (GPS), also known as the Global Navigation Satellite System (GNSS), is a satellite navigation system located approximately

Ngày tải lên: 06/10/2023, 16:05

119 13 1
building a student attendance tracking system

building a student attendance tracking system

... on their manage page Success Add successfully, teacher add to the system successfully Failure Add failed, teacher add to system failure Table 19: Acceptance request use case specification Brief ... modules are formed ⮚ Advantages: Fault localization is easier No time is wasted waiting for all modules to be developed unlike the Big-bang approach ⮚ Disadvantages: Critical modules (at the top ... Fortunately, ReactJS was born as a solution to this problem React allows you to create user interfaces that can be accessed on different search engines However, ReactJS is just a JavaScript library

Ngày tải lên: 26/09/2024, 12:53

89 0 0
STUDY OF MAXIMUM POWER POINT TRACKING  OF A WIND ENERGY CONVERSION SYSTEM USING FUZZY LOGIC

STUDY OF MAXIMUM POWER POINT TRACKING OF A WIND ENERGY CONVERSION SYSTEM USING FUZZY LOGIC

... guarantees a system at zero steady-state Trang 10tracking error for the reference inputs The major advantage of integral controllers is that they have the ability to return the controlled variable back ... data base and the rules form the knowledge base which is used to obtain the inference relation The data base contains a description of input and output variables using fuzzy sets The rule base ... tip-speed-ratio of turbine must be keep at its desired value, in spite of, variations of wind We deal with how can extract maximum power from available wind by suitable algorithm and there is

Ngày tải lên: 14/01/2021, 11:05

11 8 0
radar tracking system using contextual information on a neural network architecture in air combat maneuvering

radar tracking system using contextual information on a neural network architecture in air combat maneuvering

... Art Open literatures on target maneuvering estimation from noisy position data from radar data are very scanty A detailed literature survey has been carried out by Ananthasayanam et al [21] and ... is applied to a typical air combat maneuvering, a dogfight, a form of aerial combat between fighter aircraft Advantages of integrating contextual information in a neural network tracking approach ... current scenarios demand a great capability on the tracking and surveillance of a large number of objects moving across a vast aerial space Measure-ment data will be obtained from many and diverse

Ngày tải lên: 24/12/2022, 14:02

11 2 0
Báo cáo hóa học: " Results of Clinicians Using a Therapeutic Robotic System in an Inpatient Stroke Rehabilitation Unit" potx

Báo cáo hóa học: " Results of Clinicians Using a Therapeutic Robotic System in an Inpatient Stroke Rehabilitation Unit" potx

... biomechanical and progress data from the robotic system at baseline and at dis-charge An occupational therapist blinded to patient allocation administered the CAHAI-7 and the CMSA at admission and ... preferred a familiar Canadian measure, theCMSA This impairment measure divides arm and hand recovery into separate motor stages (1-7), allowing patients to be placed in similar bins as well as allowing ... age The covariates initial CAHAI and impair-ment score for the arm and hand and side of stroke were not significant for any outcome measure Age was a significant covariate for the outcome measures

Ngày tải lên: 19/06/2014, 08:20

12 369 0
Báo cáo toán học: " Two-stage source tracking method using a multiple linear regression model in the expanded phase domain" pdf

Báo cáo toán học: " Two-stage source tracking method using a multiple linear regression model in the expanded phase domain" pdf

... enhancement, source separation and automatic auditory system for robots [1-6] The problem of estimating relative time delay asso-ciated with a signal source and a pair of spatially sepa-rated ... Equa-tion 3 can be considered as a random variable related to the phase deviations caused by N1(ω) and N2(ω) If we assume that S(ω) = 0, and N1(ω) and N2(ω) are inde-pendent zero mean Gaussian ... arrival (DOA) angle To solve the problem, a reasonable statistical model for the distribu-tion of IPD error and its Gaussian approximadistribu-tion are presented At first, a phase domain expansion

Ngày tải lên: 20/06/2014, 20:20

19 455 0
Báo cáo hóa học: " Research Article AUTO GMM-SAMT: An Automatic Object Tracking System for Video Surveillance in Traffic Scenarios" pot

Báo cáo hóa học: " Research Article AUTO GMM-SAMT: An Automatic Object Tracking System for Video Surveillance in Traffic Scenarios" pot

... actual tracking algorithm [2,3] In this paper, we propose Auto GMM-SAMT, an automatic object detection and tracking system for video surveillance of traffic scenarios We assume that the traffic scenario ... each sequence at least 15 ground truth frames were either manually labeled or taken from [9] Overall the performance of Auto GMM-SAMT was evaluated on a total of 200 sample frames After parameter ... A complete video surveillance system for automatically tracking shape and position of objects in traffic scenarios is presented The system, called Auto GMM-SAMT, consists of a detection and a tracking

Ngày tải lên: 21/06/2014, 08:20

14 262 0
Báo cáo hóa học: " Research Article Tracking Intermittently Speaking Multiple Speakers Using a Particle Filter" doc

Báo cáo hóa học: " Research Article Tracking Intermittently Speaking Multiple Speakers Using a Particle Filter" doc

... Speakers Using a Particle Filter Angela Quinlan, Mitsuru Kawamoto (EURASIP Member), Yosuke Matsusaka, Hideki Asoh, and Futoshi Asano Central 2, 1-1-1 Umezono, Tsukuba, Ibaraki 305-8568, Japan Correspondence ... tracking process using a Kalman filter or extended Kalman filter In addition, in order to track multiple targets, a data association technique such as Joint Probability Data Association (JPDA) is exploited ... using the state transition probability, an estimate of an inactive speaker location can be kept, which is an advantage in updating the speaker location, once the speaker becomes active again Therefore,

Ngày tải lên: 21/06/2014, 20:20

11 276 0
báo cáo hóa học:" A multimodal tempo and beat-tracking system based on audiovisual information from live guitar performances" ppt

báo cáo hóa học:" A multimodal tempo and beat-tracking system based on audiovisual information from live guitar performances" ppt

... hand candidate area estimation by optical flow, (2) hand position estimation by mean shift, and (3) hand position tracking 3.2.1 Hand candidate area estimation by optical flow We use Lucas–Kanade ... summarize the precision, call and F-measure of each pattern with our audio-visual integrated beat-tracking (Integrated), au-dio only particle filter (Audio only) and Murata’smethod (Murata) Murata ... guitar performancesTatsuhiko Itohara∗1, Takuma Otsuka1, Takeshi Mizumoto1, Angelica Lim1, Tetsuya Ogata1 and Hiroshi G Okuno1 Graduate School of Informatics, Kyoto University, Sakyo, Kyoto, Japan

Ngày tải lên: 21/06/2014, 20:20

29 312 0
Báo cáo hóa học: "Research Article Rendering-Oriented Decoding for a Distributed Multiview Coding System Using a Coset Code Yuichi Taguchi and Takeshi Naemura" docx

Báo cáo hóa học: "Research Article Rendering-Oriented Decoding for a Distributed Multiview Coding System Using a Coset Code Yuichi Taguchi and Takeshi Naemura" docx

... City and Santa image sets shows a clearer advantage of our method than that for the Meeting room image set, because the former image sets are suitable for generating accurate side information Although ... Using Multiview Images We assume that multiview images are captured with calibrated cameras that roughly lie on a plane and are arranged on a 2D grid (e.g., [7 13]), and that there is no prior ... Therefore, if the cameras have a function that maps pixel values to coset indices and encodes them with an intraimage coder (e.g., the Axis 210 camera we used for the camera array has a built-in JPEG

Ngày tải lên: 22/06/2014, 00:20

12 204 0
Báo cáo hóa học: " Research Article Implementing a WLAN Video Terminal Using UML and Fully Automated Design Flow" ppt

Báo cáo hóa học: " Research Article Implementing a WLAN Video Terminal Using UML and Fully Automated Design Flow" ppt

... VGA camera and image processor The camera has a maximum frame rate of 30 fps in VGA and pix-els A photo of the board with the radio and camera cards is to PC via Ethernet (for transferring data) ... Software platform Hardware platform Application process (UML state machine) Thread 1 [activated] Thread 2 [inactive] Thread 3 [activated] Thread 1 [inactive] Thread 2 [activated] Thread 3 [inactive] ... stream packaging, managing TUTMAC, and accessing the external radio The bit stream packaging wraps the encoded bit stream into user packets of TUTMAC Class MngUser acts as a management instance

Ngày tải lên: 22/06/2014, 19:20

15 442 0
Báo cáo hóa học: " A New Position Location System Using DTV Transmitter Identification Watermark Signals" potx

Báo cáo hóa học: " A New Position Location System Using DTV Transmitter Identification Watermark Signals" potx

... tech-niques are also referred to as direction-based and distance-based techniques Direction-distance-based techniques measure the angle of arrival (AOA) using antenna array Because this AOA triangulation ... Watermark Signals Xianbin Wang, 1 Yiyan Wu, 1 and Jean-Yves Chouinard 2 1 Communications Research Centre Canada, 3701 Carling Avenue, Ottawa, Canada ON K2H 8S2 2 Department of Electrical and Computer ... transmitters in operation in the U.S.A., Canada, and Mexico The Advanced Television System Com-mittee (ATSC) DTV signals are entirely different from the analog TV signals and have many new capabilities

Ngày tải lên: 22/06/2014, 23:20

11 259 0
Báo cáo hóa học: "Particle Filtering Algorithms for Tracking a Maneuvering Target Using a Network of Wireless Dynamic Sensors" doc

Báo cáo hóa học: "Particle Filtering Algorithms for Tracking a Maneuvering Target Using a Network of Wireless Dynamic Sensors" doc

... M´ıguez and Antonio Art ´es-Rodr´ıguez Departamento de Teor´ıa de la Se˜nal y Comunicaciones, Universidad Carlos III de Madrid, Avenida de la Universidad 30, Legan´es, 28911 Madrid, Spain Received ... January 2006; Accepted 30 April 2006 We investigate the problem of tracking a maneuvering target using a wireless sensor network We assume that the sensors are binary (they transmit ’1’ for target ... of tracking a As well as in most WSN applications, the main constraints are related to the network cost of deployment and opera-tion It is desirable that the sensors be inexpensive and, as a consequence,

Ngày tải lên: 22/06/2014, 23:20

16 365 0
Vertical Shaft Plumbness Using a Laser Alignment System potx

Vertical Shaft Plumbness Using a Laser Alignment System potx

... space along the shaft The mirror and transducer are attached by a bracket that uses magnets on the turbine shaft From a single 270-degree shaft rotation, the system calculates and displays angularity ... measurement system, known as the PERMAPLUMB®, uses a self-adjusting mechanical mirror, always plumb to earth, that reflects a class 1 laser beam into a detector It requires only 14 of axial space ... Trang 1Vertical Shaft Plumbness Using a Laser Alignment System By Daus Studenberg, Ludeca, Inc ABSTRACT Traditionally, plumbness measurements on a vertical hydro-turbine/generator shaft involved

Ngày tải lên: 08/08/2014, 13:20

11 88 0
Báo cáo khoa học: " Investigation of tumor hypoxia using a twoenzyme system for in vitro generation of oxygen deficiency" pot

Báo cáo khoa học: " Investigation of tumor hypoxia using a twoenzyme system for in vitro generation of oxygen deficiency" pot

... order to evaluate cellular metabolism Cell proliferation after photon irradiation was investigated for evaluation of radioresistance under normoxia and hypoxia using both a hypoxia chamber and the ... was investigated using Agilent microar-ray chip analysis and real time PCR Cellular glucose metabolism was assessed with14C-FDG uptake assays and proliferation experiments after photon irradiation ... incubated for 24 h under normoxia and hypoxia (2% O 2 ) using the GOX/CAT system and a hypoxia chamber The ratio vital treated to vital untreated cells was determined Mean values and standard

Ngày tải lên: 09/08/2014, 09:20

12 307 0
E-DTS 2.0: A NEXT-GENERATION OF A DISTRIBUTED TRACKING SYSTEM

E-DTS 2.0: A NEXT-GENERATION OF A DISTRIBUTED TRACKING SYSTEM

... provide an accurate tracking estimate as to the current location of the object This camera communication is done over a local area network (LAN) and allows for the sharing and propagation of tracking ... that allow such a calibration but most are not intended for calibration or accuracy on a scale for wide area tracking Calibration is a two-step process that first involves preparing the camera ... techniques and methods available that provide camera calibration In most camera based calibration techniques and methods calibration takes place using physical measurement of the various points

Ngày tải lên: 24/08/2014, 10:54

88 302 0
Maximum power point tracking of a DFIG wind turbine system

Maximum power point tracking of a DFIG wind turbine system

... characteristic curve and they are called wind-data-based methods Generally, with wind-data-based methods, the MPPT ability of a wind turbine is appreciably high if accurate wind data is available ... xPQ(t) large, up to 0.3 rad/s This is unlikely with the proposed methods, as ωr(t) always approaches ωropt(t) and guarantees that the |ωr(t)−ωropt(t)| is always very small, below 0.254 rad/s and ... method can apply to both large- and-small scale wind turbines; it is more efficient and does not require any perturbation signal However, for the high inertia of a generator wind turbine system, a

Ngày tải lên: 10/05/2017, 23:02

10 302 0
Difficult situatioins recognition system for visually impaired aid using a mobile kinect

Difficult situatioins recognition system for visually impaired aid using a mobile kinect

... 4.3 Example stair image to evaluation (A)Positive sample from MICA dataset(B) Negative sample from MICA dataset (C) Positive sample from MONASHdataset (D) Negative sample from MONASH dataset ... such as stereo camera: ZED, forexample, Time-of-Flight (ToF) like ZCam, the structured light camera like Kinect,long range 3D camera Each device has it own advantages, disadvantages and onlysuitable ... off-line phase tobuild a map with image and static objects position at each location At the on-linephase, the image captured from the camera will be used to match with the database inthe learned model

Ngày tải lên: 16/07/2017, 17:26

76 178 0
w