... the data analyses and counted as dropout (cut-off: answered at least 70% of the questions) Data Analysis Data will be analysed according to the intention-to-treat principle Multiple imputations ... or a professional from Page of the medical advisory and emergency list that will be accessible at all times and how to make this contact The participants will also be informed that the study has ... Table Inclusion and exclusion criteria and reasoning Inclusion Criteria Reasoning - Minimal age of 18 years To ensure a minimal age of participation - Cocaine use > occasions in the last 30 days...
Ngày tải lên: 11/08/2014, 15:22
... operating system - Easy to manage, update database: Database is located at dedicated server that managers can maintain and update it easily - Quick delivery: web- based model make it portable ... higher performance Most of web applications today use Relational Database Management System (RDBMS) using Structure Query Language (SQL) to store and manipulate data logic There are many available ... Geographic Information system (GIS) is any system integrates hardware, software, and data for capturing, managing, analyzing, and displaying all forms of geographically referenced information...
Ngày tải lên: 27/10/2012, 16:40
Báo cáo " A web-based decision support system for the evaluation and strategic planning using ISO 9000 factors in higher education " pot
... and plan for a strategy in educational management of organizations in Vietnam and Asia [3] However, there are no DSS applications to apply a real case in the domain of an evaluation and a strategic ... applied Web- based DSS application for an evaluation and a strategic planning of educational management in Vietnam This study has contributed in effective evaluation for educational management ... standards have been adopted by more than 74 countries as national standards for quality assurance The representative of ISO for the USA is the American National Standards Institute (ANSI) and...
Ngày tải lên: 05/03/2014, 14:20
Báo cáo khoa học: "A Web-based Evaluation Framework for Spatial Instruction-Giving Systems" docx
... Harlan Hiley, Ramakrishna Vedantham, Gregory Cuellar, Alan Liuy, Natasha Gelfand, Radek Grzeszczuk, and Gaetano Borriello 2008 Landmark -based pedestrian navigation from collections of geotagged ... (GIVE): A challenge and evaluation testbed for NLG In Proceedings of the Workshop on Shared Tasks and Comparative Evaluation in Natural Language Generation Robert Dale, Sabine Geldof, and Jean-Philippe ... returning users may have learned the layout of the game world An interesting scenario is to examine how navigation systems adapt to user s increasing spatial and visual knowledge Evaluation scenarios...
Ngày tải lên: 07/03/2014, 18:20
Báo cáo khoa học: " a Web-based Tool for NLP-Assisted Text Annotation" pdf
... Conference on Natural Language Learning, pages 152–164 Association for Computational Linguistics Hamish Cunningham, Diana Maynard, Kalina Bontcheva, Valentin Tablan, Niraj Aswani, Ian Roberts, Genevieve ... judgement for each annotation As a specific realisation based on this approach, we have integrated a recently introduced machine learning -based semantic class disambiguation system capable of offering ... with BRAT for many standard formats (such as in-line and columnformatted BIO), and tools that provide standard web service interfaces can be configured to be invoked from the user interface However,...
Ngày tải lên: 17/03/2014, 22:20
Báo cáo khoa học: "A spoken dialogue interface for TV operations based on data collected by using WOZ method" pptx
... select real-time broadcast programs from 19 channels It also enables the presentation of program in- Internet Digital broadcasting TV program database Individual profile management program Program ... program database Response statements to input statements may take various forms depending on the patterns and current circumstances, and they are here generated by taking into account slot information, ... searching for program information Table 2: Content of category-slots Slot @Moviename @Performer’s name Examples Blade Runner, My Fair Lady etc Harrison Ford, Chizuru Ikewaki Norika Fujiwara,...
Ngày tải lên: 31/03/2014, 03:20
Báo cáo y học: "ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data" doc
... other additional files Additional file 2: Data for Figure S7 in Additional file Additional file 3: Data for Figure 2d Additional file 4: Archival copy of software Abbreviations ECDF: empirical cumulative ... of the Barres Lab (Stanford), Myers Lab (HudsonAlpha Institute), Ravits Lab (Benaroya Institute) and Maniatis Lab (Harvard/Columbia) for providing data and/or user feedback This work was supported ... data Brad A Friedman1,2,3* and Tom Maniatis4 Abstract RNA-Seq and microarray platforms have emerged as important tools for detecting changes in gene expression and RNA processing in biological...
Ngày tải lên: 09/08/2014, 23:20
Báo cáo y học: ":RASTA-Bacteria: a web-based tool for identifying toxin-antitoxin loci in prokaryotes" potx
... calculate a global confidence score for each ORF These are then ranked accordingly and displayed to the user in a tabular format, which ensures clear visualization of the results and allows easy ... pages Tabular view of candidates Ranked by confidence score ble in the user' s web browser (Figure 2) The results table and supporting files are then available for download as a tar archive For ... given bacterial genome: Rapid Automated Scan for Toxins and Antitoxins in Bacteria (RASTA-Bacteria) This method is based on the genomic features associated with toxins and antitoxins and the existence...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf
... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... add Clear User- Defined Exons Table mRNA (1802 nucleotides) AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACG GTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTAT ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA...
Ngày tải lên: 14/08/2014, 16:21
Báo cáo y học: "GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists" ppsx
... Biology 2007, Additional data files The following additional data are available with the online version of this article Additional data file contains an illustrative example of the GENECODIS algorithm ... operation Additional data file contains the results obtained by GENECODIS in the analysis of the yeast and human gene sets Additional data file provides a description of a comparative analysis ... property, for example genes that are differentially expressed among pathologic and normal tissues These data can provide a basis for the characterization of unknown genes, and at the same time they are...
Ngày tải lên: 14/08/2014, 17:22
Báo cáo sinh học alignminer a web based tool for detection of divergent regions in multiple sequence alignments of c
... GS1 Plant Arabidopsis thaliana GS1 Plant Arabidopsis thaliana AtGS1 isoform AF419608 tity AtGS1 isoform AY091101 GS1 Plant GS1 GS1 Plant Plant Arabidopsis thaliana AtGS1 isoform AY088312 Arabidopsis ... 5’-GATCTTTGAAGACCCTAG-3’ 18 44 48.8 5’-TCTTTCATGGTTTCCAAA-3’ 18 33 50.1 5’-AGTGCGCATTAAGGACCCATCA-3’ 22 50 61 5’-ACACACTGGCTTCCACAATAGG-3’ 22 50 59.4 5’-ACAGATGATCTAGGACATGC-3’ 20 45 52 5’-CACTTATTTGCACTTGAAGG-3’ ... Arabidopsis thaliana Arabidopsis thaliana AtGS1 isoform AtGS1 isoform AY059932 AK118005 AC# (amino acid) Q56WN1 70% Q9LVI8 Plant Oryza sativa OsGS1 isoform AB037664 Plant Oryza sativa OsGS1 isoform AB180688...
Ngày tải lên: 20/12/2015, 08:16
Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt
... Compound Ki value (lM) Reference a- keto-amide Amide Ac-FAAGRR -a keto–SL-CONH2 Ac-FAAGRR-CONH2 Ac-RTSKKR-CONH2 Ac-KKR-CONH2 Ac-FAAGRR-CHO Bz-Nle-Lys-Arg-Arg-H Bz-Ala-Lys-Arg-Arg-H Bz-Phe-Lys-Arg-Arg-H ... and RNA replication The NS3 protein (69 kDa) is a multifunctional protein with an N-terminal protease domain (NS3pro) (1–180), an RNA triphosphatase, an RNA helicase and an RNAstimulated NTPase ... The major pharmaceutical companies are currently developing a treatment against the disease A tetravalent live attenuated vaccine was developed at the Walter Reed Army Institute of Research,...
Ngày tải lên: 19/02/2014, 00:20
Beyond the Business Cycle: The Need for a Technology-Based Growth Strategy potx
... enough to allow comparative advantages to last for extended periods The advent of technology as a major tradeable asset has radically changed the dynamics of trade among nations What the centuries’ ... centuries’ old law of comparative advantage does not take into account is the fact that the basis for trade, i.e., a set of comparative advantages, can no longer be expected to remain fixed for very ... ‘Managing Open Innovation’, Research–Technology Management 47 (January–February): 23–6 Ford, William and Polina Viasenko (2011), The Downside of Monetary Easing Great Barrington, MA: American...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo khoa học: "Building trainable taggers in a web-based, UIMA-supported NLP workbench" potx
... Screen capture of Argo’s web- based interface Argo and UIMA Argo’s main user interface consists of three panels as shown in Figure The left-hand panel includes user- owned or shared storable objects; ... 2002), a suite of text processing and annotation tools, and U-Compare (Kano et al., 2010), a standalone application supporting the UIMA framework that formed the inspiration for Argo Although ... to transform some or all of the annotations and/or the subject of annotation from the CAS and serialise it into some storable format Readers, analysers and consumers are represented graphically...
Ngày tải lên: 16/03/2014, 20:20
Báo cáo khoa học: "A Web-Based Interactive Computer Aided Translation Tool" potx
... statistical machine translation methods acquire their translation knowledge in form of large phrase translation tables automatically from large amounts of translated texts (Koehn et al., 2003) For each ... words and advanced users with suggestions that are not part of their active vocabulary It may be possible that these options even allow users that not know the source language to create a translation, ... The tool updates the prediction based on the user input The predictions are based on a statistical machine translation system Given the input and the partial translation of the user (called the...
Ngày tải lên: 17/03/2014, 02:20
Báo cáo khoa học: "Evaluating Response Strategies in a Web-Based Spoken Dialogue Agent" pdf
... DARPA Speech and NL Workshop M Walker, D Litman, C Kamm, and A Abella 1997 PARADISE: A general framework for evaluating spoken dialogue agents In Proc ACL/EACL M Walker, D Litman, C Kamm, and A Abella ... success and dialogue quality factors Analysis of variance suggested that task success was a likely performance factor PARADISE confirms this hypothesis, and demonstrates that perceived rather than actual ... h~terpretation and Generation D Goddeau, H Meng, J Polifroni, S Seneff, and S Busayapongchai 1996 A form -based dialogue manager for spoken language applications In Proc ICSLP A Joshi, B Webber, and...
Ngày tải lên: 17/03/2014, 07:20
báo cáo hóa học: " Initiation of health-behaviour change among employees participating in a web-based health risk assessment with tailored feedback" pptx
... indicate that among voluntary participating employees, a web- based HRA program with tailored feedback could motivate those in greatest need of health-behaviour change A web- based HRA with tailored ... no, and not applicable Analysis All analyses included descriptive statistics to examine population characteristics, and questionnaire answers for satisfaction and initial health-behaviour change ... the central HRA database For system security and data protection reasons personal identification data and risk assessment data are stored on separate servers An electronic firewall is placed between...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: "Research Article Intersubject Differences in False Nonmatch Rates for a Fingerprint-Based Authentication System" potx
... balanced database A comparison between the full and balanced database error rates is provided in Table As can be observed, the EERs and FNMRs for the balanced database are about twice as low as for the ... capacitive sensor for the same FAR These results confirm earlier statement on quality differences between optical and capacitive sensors [19] A similar analysis was performed for the balanced database ... the range of FNMRs between subjects, EURASIP Journal on Advances in Signal Processing Table 2: Results for the Kruskal-Wallis test and analysis of variance (ANOVA) test for the optical and capacitive...
Ngày tải lên: 21/06/2014, 19:20
Teaching in a Web Based Distance Learning Environment: An Evaluation Summary Based on Four Courses pdf
... of web page layout and design HCI-2 Clear organization and presentation of information HCI-3 Consistent and easy to use web site navigation HCI-4 Aesthetically pleasing design and graphics Evaluation ... standard information on each page The following basic information should be included at the bottom of each web page: • last update date and time of page • contact information • copyright information ... the appropriate use of internal hyperlinks and anchors so that the user can easily jump around within a page Maintain consistent organization of material Attempting to keep the format of assignments...
Ngày tải lên: 28/06/2014, 21:20