... that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with the ... thing, and not by marketing a thing after some other man has done it or made it. The quality of the thing has nothing to do with the economic nature of the case; the author is, in the last analysis, ... is the case of authorship as it now stands with regard to the magazines. I am not sure that the case is in every way improved for young authors. The magazines all maintain a staff for the careful...
Ngày tải lên: 17/02/2014, 19:20
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf
... fitted as global parameters, whereas the maxi- mum response R max was fitted as a separate parameter for each binding sensorgram. The dissociation constant was obtained as K d ¼ k off ⁄ k on . NMR All ... human GABA A receptor-associated protein (GABARAP) is a protein implicated in the trafficking of GABA A receptors to the plasma membrane [2,3]. Keywords calreticulin; GABA A receptor; GABARAP; phage ... Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library Jeannine Mohrlu ¨ der 1,2 , Thomas Stangler 1,2 , Yvonne Hoffmann 1,2 , Katja Wiesehan 2 , Anja Mataruga 3 and...
Ngày tải lên: 16/03/2014, 05:20
Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx
... Theories of monogenism and polygenism. Doctrine of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth. Eurafrica, Austafrica, ... Spoken Language.—Articulate and inarticulate speech. Imitative sounds. The phonology of languages. Universal alphabets. Logical relations of the parts of speech. The vocabulary and the grammar of ... embracing all his nature and all the manifestations of his activity, in the past as well as in the present, the whole co-ordinated in accordance with the inductive methods of the natural sciences—this...
Ngày tải lên: 13/02/2014, 05:20
Reading Theory as a Microcosm of the Four Skills
... unfortunately, are dominated by the grammar-translation method of language teaching, where, as often as not, English is only taught as a means to accessing literature, be it classical, technical ... and do, participate in. This group will be familiar to many EFL teachers as they are the backbone of many schools in Ireland and Britain. One of the most important initial tasks for any teacher ... teacher is the task of knowing his clients. The notion of needs analysis is absolutely central. Even with as few details as we have outlined above, there are certain things that we can assume about...
Ngày tải lên: 06/09/2013, 10:10
Tài liệu Huntington’s Borghese Style Urn as a Study of Two-Dimensional Art & The Production of a Piece of Two-Dimensional Art pptx
... oz. water) and paint the drywall with the mixture. You can also hair spray or spray varnish to seal the drywall as well. The top of a piece of drywall is the side that tapers down at the edges, ... Remove the layer of paper from the top side of the drywall (this is the side that has the lighter color of paper). To do this, spray the surface with water until the paper peels away easily. The ... discussions of myth and mythologies. Compare the "god-like" qualities of a particular character (such as Diana, goddess of the hunt) to a modern character (such as Mia Hamm, huntress of a soccer...
Ngày tải lên: 19/02/2014, 10:20
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt
... oviduct: a regulator of local contraction and gamete transport. J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51. 111. Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... fre- quency assay. Many of the compounds in Table 1 were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and chick embryo [188,189]. In the CAM assay, many ... Velasquez LA, Maisey K, Fernandez R, Valdes D, Cardenas H, Imarai M, Delgado J, Aguilera J, Croxatto HB: PAF receptor and PAF acetylhydrolase expression in the endosalpinx of the human Fallopian...
Ngày tải lên: 05/03/2014, 17:20
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... autoradiographed. Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢;NF1mut,5¢-TTTT GGATTGAATAAAATATGATA-3¢;Site-2wt,5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢;Site-2mut,5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢;Site-3wt, 5¢-GGGTTCTTTTGGCATCCCTGTAGC-3¢;Site-3mut, 5¢-GGGTTCTTTTTAAATCCCTGTAGC-3¢. Chromatin ... [13]. Site-2 and Site-3 binding activity in all fractions was monitored by the in vitro DNase I protection assay. The DNA affinity column, used as the last step in the purification, was prepared with an ... )525 (5¢-TGACCTTGTCTCGTTGCCTCACCC-3¢)and)378 (5¢-GCTACAGGGATGCCAAAAGAACCC-3¢)forthe Site-3, and primer set )346 (5¢-GCGTCTCACCCTAGT CCTGGTCCTGC-3¢)and)214 (5¢-GGAAGGGGCGGG TCCAGAGAACA-3¢) for the Site-2 element. PCR was performed...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx
... epitopes A2 and A5 . After 25 min of chase, precipitation with mAbs A2 and A5 is almost as efficient as with mAb B1. The location of epitopes suggests that folding of ASA starts within a central part of ... h; Pro136Leu, 8 h). After the chase ASA was immunoprecipitated from the homogenates with the polyclonal ASA antiserum. Precipi- tated ASA was quantified after SDS ⁄ PAGE with a bio-imaging analyser (Fujifilm). ... ubiquitinylation of the ASA mutants, suggesting that they may be degraded in a ubiquitin-independent way by the 20S proteasome [17]. Glucosidases I and II, as well as ER a1 ,2-mannosid- ases, play a role...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
... to an increase in the rate of the initial fast phase, i.e. oxidation of the a chains. The rates of oxidation are reduced in the presence of chelators of heavy metal cations in most cases. An ... oxidation mediated by the smooth LPS was less affected by the presence of EDTA. The rough S. minnesota LPS increased the initial fast phase of the reaction, but decreased the rate of the slow phase ... 3A. The rate of auto-oxidation of cross-linked Hb was greater than that of Hb A 0, both in the presence and absence of EDTA, as has been observed previously [17]. In addition, the rates of auto-oxidation...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
... Georgetown, Texas. 25. Brunk, U.T. & Terman, A. (1999) The mitochondrial-lysosomal axis theory of cellular aging. Understanding the Basis of Aging: the Roles of Mitochondria, Free Radicals, and Antioxidants (Cadenas, ... maintenance. Mitochondria are the main source of ROS formation, as well as the main target for free radical attack. The accumulation of defective mitochondria within aging cells suggests that some are not properly autophagocytosed. Aged ... explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic errors [26,27]. Adequate support for...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
... Rac2 and S10 0A9 . Assay of NADPH oxidase activity after oxidase activation The dormant NADPH oxidase of neutrophil membranes was activated by mixing neutrophil plasma membranes and the recombinant cytosolic ... GTPcS-loaded Rac2, MgSO 4 and an optimal amount of arachidonic acid determined for each assay of oxidase activation [12]. The rate of O 2 – production by the activated NADPH oxidase was calculated ... dismutase. NADPH oxidase activity was also assayed by polarographic meas- urement of the rate of O 2 uptake at 20 °CwithaClark electrode at a voltage of 0.8 V. All experiments were carried out at...
Ngày tải lên: 18/03/2014, 01:20
The welfare state as a determinant of women’s health: support for women’s quality of life in Canada and four comparison nations pptx
... 2000 from Statistics Canada (Statistics Canada, 2002). The data and analysis related to the availability and quality of childcare for Canadian women and those from the four comparisons nations comes ... multinational business has launched a frontal assault on the state (p. 163).” Others argue: The process of the internationalization of capital- ism has fostered deep-seated economic and social changes ... to health care, increasing technology and associated costs, and the increasing perception of health as a business. All of these have contributed towards increasing privatisation of health care...
Ngày tải lên: 22/03/2014, 11:20
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC 78772–78800 79013–78981 NC_000077 Idem STOP-for STOP-rev AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG 210–237 657–631 NC_000073 ... Idem Doublecortin-for Doublecortin-rev CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG 705–728 967–943 NM_010025 Idem LIS1-for LIS1-rev CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG 1288–1303 1427–1407 NM_95116 Idem Tubulin a6 -for Tubulin a6 -rev AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 6854–6876 7646–7624 NC_000081 ... Quı ´ mica Biolo ´ gica, Facultad de Ciencias Quı ´ micas, Universidad Nacional de Co ´ rdoba, Argentina 2 Departamento de Biologı ´ a Molecular, Facultad de Ciencias Exactas, Fı ´ sico-Quı ´ micas...
Ngày tải lên: 23/03/2014, 05:22
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart. References Argue, J. (2000) Parkinson’s disease and the art of ... Responses The tango group stated on the exit questionnaire what they liked best and least about the program. They greatly appreciated the camaraderie and socialization engendered by the program. Being ... press the wand backwards (arms still behind chair). e. Finger roll: As fast as you can, then as slow as you can; Rolling out to the sides of the wand, and back to center. Come up with your own plan! From...
Ngày tải lên: 28/03/2014, 20:20
Báo cáo Y học: Purification and characterization of the thyrotropin-releasing hormone (TRH)-degrading serum enzyme and its identification as a product of liver origin doc
... enzyme SNA (Sambucus nigra A. ) – + + GNA (Galanthus nivalis A. ) + – – MAA (Maackia amurensis A. ) – – – DSA (Datura stramonium A. ) – – – ConA (Concanavalin A) + + + WGA (Wheat germ A. ) + + + PHA-L ... p lasma of neonatal rats, whereas TRH is rapidly inactivated by plasma of adult rats [39]. The endocrinological importance of this enzyme was subsequently questioned by the findings that the activity ... is released f rom the plasma membrane of hepatocytes by proteases acting as sheddases o r secretases (also designated as membrane protein-solubilizing proteases, MPSPs) [53,55–57] remains to...
Ngày tải lên: 31/03/2014, 21:21
the mit press toward a science of consciousness iii the third tucson discussions and debates oct 1999
Ngày tải lên: 11/06/2014, 13:53
Bạn có muốn tìm thêm với từ khóa: