trial version section 4 6 ownership of new files and directories

Tài liệu Báo cáo khoa học: The cellulosomes from Clostridium cellulolyticum Identification of new components and synergies between complexes ppt

Tài liệu Báo cáo khoa học: The cellulosomes from Clostridium cellulolyticum Identification of new components and synergies between complexes ppt

... 76. 1 78.7 63 .4 61 .8 56. 6 50.7 31.0 ⁄ 36 ⁄ 25 10 ⁄ 48 11 ⁄ 47 6 7 29 ⁄ 39 ⁄ 18 15.0 14. 0 15.0 14. 0 9.8 10.5 10.0 45 .0 16. 0 72.0c 77.0c 5 .4 · 105d 5.1 · 103d 50.2b 20.2b 68 .0c 249 .0c 60 .0c Cellulase ... name and ⁄ or description Reference 2209282 04 220928101 1105889 16 220928199 S-Ig-GH9-doc S-GH5 ⁄ GH30-doc S-GH10-doc S-GH11-doc 66 .1 55 .6 44 .3 29 .6 12 ⁄ 27 17 ⁄ 37 5 4 15.9 19.0 36. 0 19.0 60 .2b ... dockerin-containing proteins [ 14] The majority of these proteins are GHs belonging to families 2, 5, 8, 9, 10, 11, 18, 26, 27, 44 , 48 , 53, 62 , 74 and 95 In addition, 62 ORFs that potentially encode...

Ngày tải lên: 18/02/2014, 08:20

11 607 0
DISCRETE WAVELET TRANSFORMS - A COMPENDIUM OF NEW APPROACHES AND RECENT APPLICATIONS pdf

DISCRETE WAVELET TRANSFORMS - A COMPENDIUM OF NEW APPROACHES AND RECENT APPLICATIONS pdf

... 4. 62 5/3 Ns1 4. 73 4. 64 4 .62 4. 61 4. 61 4. 61 4. 91 4. 83 4. 81 4. 80 4. 80 4. 80 4. 89 4. 80 4. 79 4. 78 4. 78 4. 77 9/7 Ns2 Boat 9/7 Sep 9/7 Ns1 4. 93 4. 84 4.82 4. 81 4. 81 4. 81 5/3 Sep 4. 78 4. 70 4. 69 4. 69 4. 69 ... 4. 87 4. 80 4. 80 4. 79 4. 79 4. 79 9/7 Ns1 4. 85 4. 78 4. 77 4. 77 4. 77 4. 77 9/7 Ns2 4. 87 4. 80 4. 80 4. 79 4. 79 4. 79 5/3 Sep Lena 5. 06 4. 97 4. 95 4. 95 4. 95 4. 95 5/3 Ns1 5.05 4. 96 4. 94 4. 94 4. 94 4. 94 5.19 ... 5. 06 5.05 5. 04 5.05 5.05 9/7 Ns2 5.18 5.07 5. 06 5.05 5. 06 5. 06 5/3 Sep 4. 86 4. 77 4. 76 4. 75 4. 75 4. 75 5/3 Ns1 4. 85 4. 76 4. 75 4. 74 4. 74 4. 74 9/7 Sep 4. 99 4. 91 4. 89 4. 89 4. 89 4. 89 9/7 Ns1 4. 97 4. 88...

Ngày tải lên: 23/03/2014, 03:20

232 422 0
báo cáo hóa học: " A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using a head mounted display system (HMD)" doc

báo cáo hóa học: " A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual image transformation and visual stimulation by using a head mounted display system (HMD)" doc

... the 100 Left side of the test sheet Right side of the test sheet 90 80 Left side of the test sheet 100 100 94 100 70 Right side of the test sheet 60 50 80 61 60 67 40 30 44 40 20 20 10 0 Common ... 1995, 17 (6) :8 56- 867 doi: 10.11 86/ 1 743 -0003-7-20 Cite this article as: Tanaka et al., A case study of new assessment and training of unilateral spatial neglect in stroke patients: effect of visual ... Neuroscience 1990, 2:39 - 46 Plummer P, Dunai J, Morris ME: Understanding the effects of moving visual stimuli on unilateral neglect following stroke Brain and Cognition 20 06, 60 :1 56- 165 Karnath HO: Disturbed...

Ngày tải lên: 19/06/2014, 08:20

8 541 0
Báo cáo y học: "Trends towards an improved disease state in rheumatoid arthritis over time: influence of new therapies and changes in management approach: analysis of the EMECAR cohort" ppt

Báo cáo y học: "Trends towards an improved disease state in rheumatoid arthritis over time: influence of new therapies and changes in management approach: analysis of the EMECAR cohort" ppt

... (baseline) 0 .62 (0.57 to 0 .67 )*** 0.53 (0 .48 to 0.59)*** 0. 24 (0.2 to 0.28)*** -0.1 (-0.13 to 0.07)*** 6. 79 (5 .42 to 8.15)*** 0 .68 (0. 26 to 1.11)** HAQ score (each visit) - - - - 4. 92 (3 .61 to 6. 24) *** ... 0.08 (-0.05 to 0.21) -0.5 (-0. 14 to 0. 04) - -1 .44 ( -4. 71 to 1. 84) - Peptic ulcer 0.17 (-0.13 to 0 .47 ) - 0.15 (0.02 to 0.28)* 0.05 (-0.03 to 0.13) 1.30 (-3. 06 to 5 .66 ) - Myocardial ischemia -0.05 ... to to0 .42 ) 0. 06 (-0.09 to 0.21) -0 .49 ( -6. 56 to 5.58) - Heart failure 0.31 (0. 04 to 0.59)* 0. 06 (-0.21 to 0.33) 0. 36 (0.21 to 0.50)*** - -0. 74 (-7.21 to 5.72) - Stroke 0.15 (-0.2 to 0 .49 ) - 0.02...

Ngày tải lên: 09/08/2014, 13:22

10 429 0
Báo cáo y học: "Low incidence of new biochemical and clinical hypogonadism following hypofractionated stereotactic body radiation therapy (SBRT) monotherapy for low- to intermediate-risk prostate cancer" pps

Báo cáo y học: "Low incidence of new biochemical and clinical hypogonadism following hypofractionated stereotactic body radiation therapy (SBRT) monotherapy for low- to intermediate-risk prostate cancer" pps

... 61 .2) 50 .6 (25.7 - 56. 7) 49 (27.1 - 57.2) 12 Month 49 (27 .6 - 59.8) SF-12 MCS 54. 8 (37.2 - 61 .3) 54. 4 (41 .2 - 61 ) 55.2 (37.3 - 63 .2) 55.7 ( 34. 5 - 61 .5) 57 (47 .1 - 64 . 7) 56. 5 (38.5 - 62 .6) AUA 6. 8 ... Cau 6. 9 1c 3 +4 Intermediate 40 20 62 Cau 5 .6 1c 3+3 Low 25 23 21 63 AA 6. 2 1c 3 +4 Intermediate 42 15 22 69 AA 5.8 1c 3 +4 Intermediate 42 18 23 71 AA 5.9 1c 3+3 Low 34 24 24 65 Cau 7 .4 1c 4+ 3 ... AUA SHIM 60 Cau 4. 7 1c 3+3 Low 53 20 69 Cau 6. 8 1c 3 +4 Intermediate 46 14 69 Cau 6. 1 1c 3+3 Low 29 60 Cau 4. 5 1c 3+3 Low 21 18 71 AA 4. 0 1c 2+3 Low 31 16 19 72 Cau 5 .6 1c 3+3 Low 41 56 AA 5.7...

Ngày tải lên: 10/08/2014, 21:23

9 353 0
Báo cáo y học: "Impact of the introduction of new vaccines and vaccine wastage rate on the cost-effectiveness of routine EPI: lessons from a descriptive study in a Cameroonian health district" potx

Báo cáo y học: "Impact of the introduction of new vaccines and vaccine wastage rate on the cost-effectiveness of routine EPI: lessons from a descriptive study in a Cameroonian health district" potx

... 20, 949 8,001 Babla 47 1,313 288,8 26 8, 569 10 ,69 7 Kismatari 389,303 202,815 29, 9 46 14, 487 Djefatou 48 2 ,43 8 11 ,48 7 / Karewa 2 36, 879 140 ,397 12 , 46 7 10,800 L Tchitta 362 ,935 43 9 ,66 1 20, 163 14, 65 5 ... 898,7 16 10,573 / L Massa Ngong 528 ,62 5 1,787 , 46 5 42 7 ,47 9 1,012,9 14 9,9 74 7,208 8,7 24 14, 470 Boumedje 49 5 ,49 1 163 , 64 1 7,507 163 , 64 1 /0 important part of this excess cost was due to the loss of newer, ... 1,037 8 ,41 8 1 .4 Penta 5% 165 145 230,505 202, 565 43 3,070 72.7 Measles 25% 137 219 12,0 56 19,272 31,328 5.3 YFV 25% Total 137 219 44 ,66 2 71,3 94 1 16, 0 56 19.5 708 60 0 301,2 64 2 94, 268 595,532 100 and...

Ngày tải lên: 13/08/2014, 11:22

8 304 0
Investigation of new properties and applications of quadruplex DNA and development of novel oligonucleotide based topoisomerase i inhibitors

Investigation of new properties and applications of quadruplex DNA and development of novel oligonucleotide based topoisomerase i inhibitors

... by DNAse I 64 4-8 Effect of mismatched sequences on the circularization reaction 66 4- 9 Effect of recessive sequences on the circularization reaction 67 4- 2 4- 3 4- 4 4- 5 4- 10 Effect of loop size ... 6. 1.1 Oligonucleotides 108 6. 1.2 Enzymes 108 6. 1.3 PBR 322 DNA 1 14 6. 1 .4 Buffer 115 6. 2 Methodology 1 16 6.2.1 5’ End Labeling of DNA (T4 Polynucleotide Kinase Method) 1 16 6.2.2 Polyacrylamide Gel ... the template basis of G-quadruplex and time course of the ligation reaction 62 4- 6 Hydrolysis of the identified circular products by exonuclease 64 4-7 Partial hydrolysis of the identified circular...

Ngày tải lên: 11/09/2015, 16:04

158 359 0
Characterization of new peptides and physiological amino acids present in cerebrospinal fluid of chronic pain patients

Characterization of new peptides and physiological amino acids present in cerebrospinal fluid of chronic pain patients

... 13 1 .4. 2.1 Glutamate 13 1 .4. 2.2 Aspartate 14 1 .4. 2.3 Glycine 16 1 .4. 2 .4 GABA 1 .4. 2.5 1 .4. 3 17 18 Other amino acids Small molecule neurotransmitters – Others 19 1 .4. 3.1 Acetylcholine 19 1 .4. 3.2 ... Adenosine 20 1 .4. 3.3 Nitric Oxide 20 1 .4. 3 .4 Prostaglandins 21 1 .4. 4 Opioid peptides 23 1 .4. 5 Neuroactive peptides – Tachykinins 28 1 .4. 5.1 Substance P 28 1 .4. 5.2 Neurokinins 29 1 .4. 6 Neuroactive ... Bradykinins 30 1 .4. 7 Other neuroactive peptides 31 1 .4. 7.1 Nocistatin 31 1 .4. 7.2 Neurotensin 31 1 .4. 7.3 Somatostatin 32 1 .4. 7 .4 Cholecystokinin 32 1.5 Aim and scope of this study 34 Introduction...

Ngày tải lên: 12/09/2015, 09:55

218 268 0
Studies of new properties and applications of g quadruplex DNA

Studies of new properties and applications of g quadruplex DNA

... Chapter 42 3.2 .4 Proposed mechanism 44 3.3 Conclusion 44 3 .4 References 45 Discovery of site specific self-cleavage of G-quadruplexes 47 formed by yeast telemetric repeats 4. 1 Introduction 47 iv 4. 2 ... 4B2-T, 4B3-T, 4B4-T, 4B5-T, 4B6-T and 4B7-T (see Table 2-1) respectively Lane and Lane 2: reactions of 4B1-T lasting for and 120 respectively; Lane and Lane 4: reactions of 4B2-T (5’ TGGCGTTAGAGGAAAAGGTTAGGGGTTAGG ... for that pH of the buffer solutions were 6. 0 (lane 2), 6. 2 (lane 3), 6 .4 (lane 4) , 6. 6 (lane 5), 6. 8 (lane 6) , 7.0 (lane 7), 7.2 (lane 8), 7 .4 (lane 9), 7 .6 (lane 10), 7.8 (lane 11) and 8.0 (lane...

Ngày tải lên: 16/10/2015, 12:00

80 239 0
Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt

Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt

... 3.9 4. 27 65 .9 4. 12 71.8 3 .66 67 .7 3. 36 67.2 3 .47 76. 9 3.71 61 .7 4. 45 74. 2 4. 3 3.93/3 .65 64 . 6 4. 04/ 3.93 64 . 7 3.71/3 .45 63 .7 4. 08 67 .7 4. 24 69 .5 3 .69 73.0 3 .67 73 .6 5 . 46 97.8 175.0 101.7 175.0 100.9 ... 78.3 4. 14 78.2 4. 27 77.5 4. 05 67 .4 4.02 71.5 4. 16 71.7 4. 73 105.8 4. 67 1 04. 7 4. 47 103.5 3 .44 75.3 2.70 58.2 2 .67 56. 9 3.71 72.9 3. 54 76. 6 3 .66 73.5 3 .43 75.8 3.71 77.7 3.82 73 .4 3.9 4. 27 65 .9 4. 12 ... 4. 59/3. 96 62 .4 4. 26 49 .8 3 .67 56. 1 3.29 73.5 2.0–2.1 22.3 4. 12 77.3 3 .67 72 .6 3 .49 75 .6 4. 39 75.0 3 .61 73 .6 3 .48 70.1 4. 12 73.5 3 .41 70.0 3 .40 76. 9 4. 63 (4. 46) 71.2 (70.2) )9.7/)5.5 (3.2) 3.72 60 .1...

Ngày tải lên: 19/02/2014, 13:20

14 719 0
Báo cáo khoa học: Subunit sequences of the 4 · 6-mer hemocyanin from the golden orb-web spider, Nephila inaurata Intramolecular evolution of the chelicerate hemocyanin subunits pot

Báo cáo khoa học: Subunit sequences of the 4 · 6-mer hemocyanin from the golden orb-web spider, Nephila inaurata Intramolecular evolution of the chelicerate hemocyanin subunits pot

... NinHc-f NinHc-g AJ 547 807 AJ 547 808 AJ 547 809 AJ 547 810 AJ 547 811 AJ 547 812 2 067 2 060 2327 21 06 2152 2059 63 0 62 8 62 7 62 5 62 6 62 6 72.09 72.59 71. 94 71.00 71.73 71.19 5.39 6. 06 6. 36 5 .49 6. 09 5.88 a Without ... AF099 741 ), Pacifastacus leniusculus (X8 349 4), Marsupenaeus japonicus (AB 065 371), Tenebrio molitor (AB020738), Bombyx mori (D49370, D49371 and E12578), and Sarcophaga bullata (AF 161 260 and AF 161 261 )) ... EcaHc-f EcaHc-g 72.0 66 .4 70.1 69 .6 70.1 69 .6 76. 2 69 .1 74. 9 71.3 76. 2 72.8 Fig Timescale of the evolution in the chelicerate hemocyanin subunits The grey bars are the standard errors Abbreviation:...

Ngày tải lên: 08/03/2014, 08:20

8 417 0
Báo cáo khoa học: Effect of heliquinomycin on the activity of human minichromosome maintenance 4/6/7 helicase pdf

Báo cáo khoa học: Effect of heliquinomycin on the activity of human minichromosome maintenance 4/6/7 helicase pdf

... of MCM4 /6/ 7 helicase to heliquinomycin 17-mer % Tag MCM 0 .43 1 .4 4.3 (μM) HQ 14 43 + Werner 1 .4 0 .43 4. 3 14 43 (μM) HQ 17-mer/M13 B 17-mer 120 100 % 80 60 40 20 33 84 0 .43 4. 3 1 .4 (μM) HQ 14 43 ... understand the mechanism by which heliquinomycin inhibits the activity of MCM4 /6/ 7 helicase, we 10 nt 120 100 % 80 60 40 20 B 0 .43 1 .4 4.3 HQ (μM) 14 0 .43 1 .4 4.3 (μM) HQ 14 43 100 % 80 60 40 20 43 ... form of the MCM4 /6/ 7 complex 0 .43 1 .4 4.3 14 43 (μM) HQ ATP 120 100 Tag % 80 60 (4/ 6/ 7)2 20 (4/ 6/ 7) 44 0 kDa Fig Effect of increasing concentrations of heliquinomycin (HQ) on the formation of the...

Ngày tải lên: 23/03/2014, 04:21

10 541 0
Báo cáo hóa học: " Grafting of 4-(2,4,6-Trimethylphenoxy)benzoyl onto Single-Walled Carbon Nanotubes in Poly(phosphoric acid) via Amide Function" pot

Báo cáo hóa học: " Grafting of 4-(2,4,6-Trimethylphenoxy)benzoyl onto Single-Walled Carbon Nanotubes in Poly(phosphoric acid) via Amide Function" pot

... adma.20 060 1310 11 J.-B Baek, L.-S Tan, Polymer (Guildf) 44 , 41 35 (2003) doi: 10.10 16/ S0032-3 861 (03)003 74- 4 12 J.-B Baek, C.B Lyons, L.-S Tan, J Mater Chem 14, 2052 (20 04) doi:10.1039/b40 140 1d 13 ... SWCNT TMPBA-g-SWCNT 1 64 8 TMPBA Intensity (a.u.) Transmittance (a.u.) TMPBA-g-SWCNT 1233 2919 3215 G: 1599 D: 1273 RBM: 85.29, 162 .43 G: 1595 33 86 1 64 1 RBM: 83. 36, 160 .50 1 247 40 00 3500 3000 2500 ... Saito, A Jorio, Phys Rep 40 9, 47 (2005) doi:10.10 16/ j.physrep.20 04. 10.0 06 26 T Shimada, H Yanase, K Morishita, J Hayashi, T Chiba, Carbon 42 , 163 5 (20 04) doi:10.10 16/ j.carbon.20 04. 02.019 123 Nanoscale...

Ngày tải lên: 22/06/2014, 00:20

7 346 0
Báo cáo hóa học: " Elastic Properties of 4–6 nm-thick Glassy Carbon Thin Films" pot

Báo cáo hóa học: " Elastic Properties of 4–6 nm-thick Glassy Carbon Thin Films" pot

... Lett 2, 46 5 46 7 (1999) C.L Burket, R Rajagopalan, A.P Marencic, K Dronvajjala, H.C Foley, Genesis of porosity in polyfurfuryl alcohol derived nanoporous carbon Carbon 44 , 2957–2 963 (20 06) C.L ... Synthesis, properties and applications Microporous Mater 4, 40 7 43 3 (1995) C.J Anderson, S.J Pas, G Arora, S.E Kentish, A.J Hill, S.I Sandler, G.W Stevens, Effect of pyrolysis temperature and operating ... function) of the domains in glassy carbon tapers off beyond a distance of about 1.2 nm [29] Using r0 = 1.2 nm and Ebulk = 30 GPa gives a surface elastic constant of 36 N/m and a modulus value of 59...

Ngày tải lên: 22/06/2014, 00:20

6 368 0
.Thank you for trying Solid Converter PDF. The trial version of this product only converts 10% of ppsx

.Thank you for trying Solid Converter PDF. The trial version of this product only converts 10% of ppsx

... trying Solid Converter PDF The trial version of this product only converts 10% of your document, with a 10 page maximum For this conversion, Solid Converter PDF converted of pages Please register Solid...

Ngày tải lên: 24/07/2014, 01:20

2 316 0
Báo cáo toán học: "omputation of the vertex Folkman numbers F (2, 2, 2, 4; 6) and F (2, 3, 4; 6)" pdf

Báo cáo toán học: "omputation of the vertex Folkman numbers F (2, 2, 2, 4; 6) and F (2, 3, 4; 6)" pdf

... 3, 4) that G → (2, 2, 2, 4) Therefore F (2, 2, 2, 4; 6) ≤ F (2, 3, 4; 6) and hence it is sufficient to prove that F (2, 3, 4; 6) ≤ 14 and F (2, 2, 2, 4; 6) ≥ 14 Proof of the inequality F (2, 3, 4; ... F (4, 4; 6) = 14 [ 14] In this note we determine two additional numbers of this type Theorem D F (2, 2, 2, 4; 6) = F (2, 3, 4; 6) = 14 These two numbers are known to be less than 36 (see [4] , ... + Q)| = 14, then F (2, 3, 4; 6) ≤ 14 Proof of the inequality F (2, 2, 2, 4; 6) ≥ 14 Let G → (2, 2, 2, 4) and cl(G) < We need to prove that |V (G)| ≥ 14 It is clear from G → (2, 2, 2, 4) that G...

Ngày tải lên: 07/08/2014, 06:23

7 382 0
báo cáo khoa học: " The IGNITE (investigation to guide new insight into translational effectiveness) trial: Protocol for a translational study of an evidenced-based wellness program in fire departments" ppsx

báo cáo khoa học: " The IGNITE (investigation to guide new insight into translational effectiveness) trial: Protocol for a translational study of an evidenced-based wellness program in fire departments" ppsx

... The irrelevance of evidence in the development of school-based drug prevention policy, 19 86- 19 96 Eval Rev 1998, 22(1):118 - 46 Pelletier KR: A review and analysis of the clinical and cost-effectiveness ... Sunday 20 06, B03[http://www.washingtonpost.com/wpdyn/content/article/20 06/ 01/ 06/ AR20 060 1 060 2 269 .html] Durlak JA, DuPre EP: Implementation matters: a review of research on the influence of implementation ... 51(5):329-335 16 Walton SM, Conrad KM, Furner SE, Samo DG: Cause, type, and workers’ compensation costs of injury to fire fighters Am J Indust Med 2003, 43 :45 4 -45 8 17 Green JS, Crouse SF: Mandatory...

Ngày tải lên: 10/08/2014, 10:23

8 402 0
w