treatment of a partially edentulous patient with fixed and removable prostheses

báo cáo khoa học: "Successful treatment of a T4 lung tumor with vertebral body invasion using fiducial markers in the thoracic spine for image-guided radiation therapy: A case report" pps

báo cáo khoa học: "Successful treatment of a T4 lung tumor with vertebral body invasion using fiducial markers in the thoracic spine for image-guided radiation therapy: A case report" pps

... Shirato H, Harada T, Harabayashi T, Hida K, Endo H, Kitamura K, Onimaru R, Yamazaki K, Kurauchi N, Shimizu T, Shinohara N, Matsushita M, DosakaAkita H, Miyasaka K: Feasibility of insertion/implantation ... data, and performed literature review JH performed the implantation of the fiducial markers LJS analyzed and interpreted the patient data and conducted the literature review All authors read and ... megavoltage (MV) images and allow for matching of patient anatomy to bony landmarks on a DRR Yin et al [8] at Henry Ford Hospital have used KV X-ray imaging with anatomy matching to vertebral bodies...

Ngày tải lên: 10/08/2014, 23:20

5 280 0
báo cáo hóa học: " Multinational development of a questionnaire assessing patient satisfaction with anticoagulant treatment: the ''''Perception of Anticoagulant Treatment Questionnaire'''' (PACT-Q©)" docx

báo cáo hóa học: " Multinational development of a questionnaire assessing patient satisfaction with anticoagulant treatment: the ''''Perception of Anticoagulant Treatment Questionnaire'''' (PACT-Q©)" docx

... important aspects of their treatment and disease management, 3) identify how patients assess the efficacy and safety of their anticoagulant treatment and their preferences, 4) identify advantages and ... generate an initial list of concepts related to the expectations and satisfaction of patients with anticoagulant treatment The concept list was created in English and was based on the patients' main ... concepts were initially grouped into three areas of interest: 1) Treatment, 2) Disease and Complications and 3) Information about disease and anticoagulant treatment After clinician and patient interviews,...

Ngày tải lên: 18/06/2014, 19:20

13 585 0
Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report" docx

Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report" docx

... was placed in the anatomic position Part of the native head was used as a morselised autograft at the true acetabular bed The superolateral part of the head was used as a structural graft and secured ... technical difficulties of antegrade nailing due to the distorted anatomy and the limited ability of intraoperative traction and manipulation because of hip ankylosis in 15° of flexion and as a result ... Tsakotos et al.: Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report Journal of Medical Case Reports 2010 4:221 Figure Distal anteroposterior X-ray at...

Ngày tải lên: 11/08/2014, 03:20

4 357 0
Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case repor" ppt

Báo cáo y học: "Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case repor" ppt

... was placed in the anatomic position Part of the native head was used as a morselised autograft at the true acetabular bed The superolateral part of the head was used as a structural graft and secured ... technical difficulties of antegrade nailing due to the distorted anatomy and the limited ability of intraoperative traction and manipulation because of hip ankylosis in 15° of flexion and as a result ... Tsakotos et al.: Treatment of a femoral shaft fracture in a patient with congenital hip disease: a case report Journal of Medical Case Reports 2010 4:221 Figure Distal anteroposterior X-ray at...

Ngày tải lên: 11/08/2014, 06:23

4 291 0
báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot

báo cáo hóa học:" Functional bracing for delayed union of a femur fracture associated with Paget''''s disease of the bone in an Asian patient: a case report" pot

... disease in Australia, New Zealand, North America and most European countries, but it has a low incidence in Scandinavia, and is extremely rare in the Japanese population, with a prevalence of ... as: Takigami et al., Functional bracing for delayed union of a femur fracture associated with Paget's disease of the bone in an Asian patient: a case report Journal of Orthopaedic Surgery and ... and treatment J Oral Pathol Med 1994, 23:12-16 Hashimoto J, Ohno I, Nakatsuka K, Yoshimura N, Takata S, Zamma M, Yabe H, Abe S, Terada M, Yoh K, et al.: Prevalence and clinical features of Paget's...

Ngày tải lên: 20/06/2014, 04:20

4 403 0
Báo cáo khoa học: "Surgical treatment of a rare primary renal carcinoid tumor with liver metastasis" docx

Báo cáo khoa học: "Surgical treatment of a rare primary renal carcinoid tumor with liver metastasis" docx

... with advanced disease Response rate has been variable and may correlate to octreotide scan, but stabilization of disease has been seen in 36 to 70% of patients, with a mean duration of 12 months ... year after her initial surgery, with no evidence of tumor recurrence Case presentation We evaluated a 45 year-old patient who presented initially with abdominal pain Abdominal and pelvic CT scan ... tumors of renal origin are usually carcinoids, and fewer than 56 cases have been reported in the literature [5] There is an interesting, and as yet unexplained, association of renal carcinoids with...

Ngày tải lên: 09/08/2014, 07:21

4 331 0
Báo cáo y học: "Heel raises versus prefabricated orthoses in the treatment of posterior heel pain associated with calcaneal apophysitis (Sever’s Disease): study protocol for a randomised controlled trial" ppt

Báo cáo y học: "Heel raises versus prefabricated orthoses in the treatment of posterior heel pain associated with calcaneal apophysitis (Sever’s Disease): study protocol for a randomised controlled trial" ppt

... reliable data being available regarding calcaneal apophysitis causation and no clinical trial comparing treatment approaches, no clinical treatment path can be determined as “best practice” [19], therefore ... deviation and weight standard deviation, will be collected for all participants at the baseline assessment along with the Foot Posture Index-6 (FPI-6), a clinical standardised measure of a participant’s ... the calcaneal apophysis (i.e., posterior aspect of heel) with pain on palpation (positive calcaneal squeeze medial and lateral borders), have not in the last 12 months been diagnosed fracture...

Ngày tải lên: 10/08/2014, 21:24

7 521 0
báo cáo khoa học: "Successful treatment of a free-moving abdominal mass with radiation therapy guided by conebeam computed tomography: a case report" potx

báo cáo khoa học: "Successful treatment of a free-moving abdominal mass with radiation therapy guided by conebeam computed tomography: a case report" potx

... analyzed and interpreted the patient data regarding the radiation treatment MRS analyzed the technical data, particularly use of the conebeam CT PH helped obtain consent and provided patient care ... part of vertebral body S2 Disease was evident in the mediastinum and right pleural area but was not causing any symptoms at that time, and the decision was made to administer palliative radiation ... Cite this article as: Dabaja et al.: Successful treatment of a free-moving abdominal mass with radiation therapy guided by cone-beam computed tomography: a case report Journal of Medical Case Reports...

Ngày tải lên: 11/08/2014, 02:21

4 375 0
báo cáo khoa học: "Development of a duodenal gallstone ileus with gastric outlet obstruction (Bouveret syndrome) four months after successful treatment of symptomatic gallstone disease with cholecystitis and cholangitis: a case report" pps

báo cáo khoa học: "Development of a duodenal gallstone ileus with gastric outlet obstruction (Bouveret syndrome) four months after successful treatment of symptomatic gallstone disease with cholecystitis and cholangitis: a case report" pps

... the day of admission revealed a normal pancreatic duct and a small pigmented gallstone of the CBD that was extracted with an extraction balloon after endoscopic Page of Table Laboratory data for ... count of 14.3 cells/nL, an elevated C-reactive protein (CRP) level of 25.9 mg/dL, mildly elevated plasma aspartate aminotransferase and alanine aminotransferase (AST and ALT) levels of 51 U/L and ... on a CT scan and because we were planning a one-stage surgery, we performed a laparotomy instead of choosing a laparoscopic approach Conclusion In a patient with gallstone disease with abdominal...

Ngày tải lên: 11/08/2014, 02:22

5 273 0
báo cáo khoa học: " Successful treatment of metastatic hepatic epithelioid hemangioendothelioma with thalidomide: a case report" potx

báo cáo khoa học: " Successful treatment of metastatic hepatic epithelioid hemangioendothelioma with thalidomide: a case report" potx

... pulmonary, hepatic and retroperitoneal metastases, with stable disease after seven years of follow-up Thalidomide is a low toxicity agent that acts as an inhibitor of vascular neogenesis, and seems ... disease bulk with thalidomide treatment; however, our patient has remained clinically and radiologically stable over a period in excess of seven years More recently, the case of a patient treated ... contributions All the authors have read and approved the final version of this manuscript CR, EH and PS assembled the clinical data and wrote the paper EH, LW, JL and PS were involved in the clinical care...

Ngày tải lên: 11/08/2014, 02:22

4 296 0
Báo cáo y học: " Successful treatment of HIV-associated multicentric Castleman’s disease and multiple organ failure with rituximab and supportive care: a case report" potx

Báo cáo y học: " Successful treatment of HIV-associated multicentric Castleman’s disease and multiple organ failure with rituximab and supportive care: a case report" potx

... creatinine and was admitted to the ICU for haemofiltration Antiretroviral therapy was continued on the ICU with ritonavir-boosted lopinavir and saquinavir Abacavir and lamivudine, which the patient was ... with autoimmune haemolytic anaemia (AIHA), a recognised association of MCD In addition she had elevated prothrombin (PT) and activated partial thromboplastin times (APTT), reduced platelets and ... prognosis, with a year mortality of 88% for haemato-oncological patients However, such patients may not fare so badly on ICU if organ support facilitates administration of a specific therapy for a treatable...

Ngày tải lên: 11/08/2014, 14:21

6 340 0
Báo cáo y học: " Prevalence of metabolic syndrome in patients with schizophrenia, and metabolic changes after 3 months of treatment with antipsychotics results from a German observational study" doc

Báo cáo y học: " Prevalence of metabolic syndrome in patients with schizophrenia, and metabolic changes after 3 months of treatment with antipsychotics results from a German observational study" doc

... month-3 At baseline, patient demographics and characteristics were recorded At both visits, vital and physical parameters were collected, and fasting blood samples were drawn and analyzed Apart from ... Few data are available so far on the prevalence of MetS in schizophrenia patients in Germany In our observational study we addressed this gap, assessing the prevalence of MetS at baseline and ... resulted in treatment guidelines which demand the regular monitoring of relevant physical and laboratory parameters; in several countries these are meanwhile regarded clinical standard of care [21,22]...

Ngày tải lên: 11/08/2014, 16:20

11 426 0
Báo cáo y học: " A patient with bacteraemia and possible endocarditis caused by a recently-discovered genomospecies of Capnocytophaga: Capnocytophaga genomospecies AHN8471: a case report" potx

Báo cáo y học: " A patient with bacteraemia and possible endocarditis caused by a recently-discovered genomospecies of Capnocytophaga: Capnocytophaga genomospecies AHN8471: a case report" potx

... carotid sheaths In 2b (after days of antibiotic therapy), the appearance of the disease process has changed (in comparison to 2a) with a decreasing amount of air in the soft tissues and replacement ... postoperative day and the wound was allowed to heal by secondary intention Inflammatory markers progressively came back to normal and the patient was discharged on the 18th day after admission He was ... discussions with a radiologist it was decided to carry out a limited surgery in the form of incision and drainage About 200 ml of pus was drained via a small transverse suprasternal incision and midline...

Ngày tải lên: 11/08/2014, 19:21

5 220 0
Báo cáo y học: " A patient with bacteraemia and possible endocarditis caused by a recently-discovered genomospecies of Capnocytophaga: Capnocytophaga genomospecies AHN8471: a case report" pps

Báo cáo y học: " A patient with bacteraemia and possible endocarditis caused by a recently-discovered genomospecies of Capnocytophaga: Capnocytophaga genomospecies AHN8471: a case report" pps

... of a husky, weak, hoarse voice He was a lifelong heavy smoker (50 pack years) and had formerly had an excessive alcohol intake On examination, he was apyrexial with no lymphadenopathy, but was ... lymphadenopathy, hepatic lesions consistent with metastases, a mass in the left adrenal gland, several areas of renal infarction bilaterally, but no cerebral metastatic deposits Barium swallow ... day of admission became positive after days incubation Gram-negative rods were isolated from both aerobic and anaerobic Our case shows again the potential for Capnocytophaga to cause bacteraemia...

Ngày tải lên: 11/08/2014, 19:21

3 239 0
báo cáo khoa học:" Development and validation of a questionnaire on ‘Satisfaction with dermatological treatment of hand eczema’ (DermaSat)" potx

báo cáo khoa học:" Development and validation of a questionnaire on ‘Satisfaction with dermatological treatment of hand eczema’ (DermaSat)" potx

... with treatment, a parameter that seems to have a substantial influence on quality of life and therapeutic compliance [4-6] Patient satisfaction is related to all aspects of health care that are ... (0.32) and glaucoma (0.30) treatments; and also with General Satisfaction Page 13 of 16 (0.59), as compared to generic (0.35) and glaucoma (0.28) Summarizing, the structure of patient treatment satisfaction ... doi:10.1186/1477-7525-8-127 Cite this article as: Ruiz et al.: Development and validation of a questionnaire on ‘Satisfaction with dermatological treatment of hand eczema’ (DermaSat) Health and Quality of Life Outcomes...

Ngày tải lên: 12/08/2014, 01:21

16 439 0
Bóa cáo y học: "Erroneous measurement of haemodynamic parameters by PiCCO™ monitor in a critically ill patient with renal replacement therapy: a case report" pot

Bóa cáo y học: "Erroneous measurement of haemodynamic parameters by PiCCO™ monitor in a critically ill patient with renal replacement therapy: a case report" pot

... patient was admitted They discovered the erroneous measurement with the help of EC -A, who was in charge of the patient the following day All authors participated in the draft of the manuscript, and ... intensive care unit: Clinical review Crit Care 2002, 6:52-59 Sakka SG, Ruhl CC, Pfeiffer UJ, Beale R, MvLuckie A, Reinhart K, Meier-hellmann A: Assessment of cardiac preload and extravascular lung water ... there was an alteration of the area under the curve obtained by the injection of cool saline We think the same alteration would be produced by any catheter, if calibration is done during haemodialysis,...

Ngày tải lên: 12/08/2014, 23:23

2 273 0
Báo cáo y học: "Endovascular Treatment of Bilateral Carotid Artery Occlusion with Concurrent Basilar"

Báo cáo y học: "Endovascular Treatment of Bilateral Carotid Artery Occlusion with Concurrent Basilar"

... beginning of the ICA Begnning of the ICA Symptom Other aeurysms SAH PCA SAH No SAH No Hydrocephalus No Thalamic hematoma Collateral circulation VA→ECA→IC A Subclavian artery →CCA→ICA ECA→ICrA No SCA+AICA+PIC ... horn of the right ventricle The patient was diagnosed with SAH, diabetes and hypertension CTA showed an aneurysm at the apex of the basilar artery with a diameter of 3.2 mm There was no signal at ... external carotid artery to anastomosis of the intracranial artery; in one case, no anastomosis 3.3 Treatment (1) Basilar apex aneurysm: conservative treatment in cases, clipping treatment by craniotomy...

Ngày tải lên: 25/10/2012, 11:04

7 518 0
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

... states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel are already being sold to the public sector oil companies ... supplement in animal feed, if the toxins are removed [23] Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen ... using heated distilled water was carried out to remove some unreacted remainder of methanol and catalyst which if not removed can react and damage storing and fuel carrying parts During washing...

Ngày tải lên: 05/09/2013, 16:11

12 571 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC...

Ngày tải lên: 18/02/2014, 14:20

16 647 0
Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx

Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx

... pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a gene-specific sense primer (5¢-GCCG CTCGAGTTTGAGTTAGCCAGAAACTCC-3¢, ... and precipitated using EtOH and sodium acetate After extensive washing the DNA was redissolved in Tris/EDTA, pH 8.0 and separated on a · Tris/borate/EDTA, 0.9% agarose gel After capillary transfer ... of the order rodentia using the same data as Graur In contrast, the distance matrix algorithms again placed the guinea pig together with artiodactyls and primates, thus supporting paraphyly albeit...

Ngày tải lên: 22/02/2014, 07:20

9 672 0
w