transparent access to remote data using a private database link

Tài liệu Using XPath to Query Data in a DataSet doc

Tài liệu Using XPath to Query Data in a DataSet doc

... ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.Fill(orderTable); ds.Tables.Add(orderTable); // Fill the OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT ... { ds = new DataSet("Orders_OrderDetails"); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); ... [Order Details]", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); da.Fill(orderDetailTable); ds.Tables.Add(orderDetailTable);...

Ngày tải lên: 26/01/2014, 10:20

4 443 0
Báo cáo sinh học: " The analysis of disease biomarker data using a mixed hidden Markov model (Open Access publication)" ppt

Báo cáo sinh học: " The analysis of disease biomarker data using a mixed hidden Markov model (Open Access publication)" ppt

... HMM was assessed on simulated data based on parameters obtained in a survey of clinical mastitis cases Bayesian estimates of the parameters were obtained using the Gibbs sampler Finally, limitations ... bulls, each cow was replaced by a daughter and mating was at random Breeding values for base animals were sampled from a normal distribution with null mean and additive variance of 0.15 or 0.25 Values ... replicated 10 times Simulated rather than real data were used because a negative diagnosis, even based on the absence of bacteria in cell culture, is not a guarantee of health and the opposite has...

Ngày tải lên: 14/08/2014, 13:21

19 390 0
Tài liệu Modifying Data Using a Strongly Typed DataSet pptx

Tài liệu Modifying Data Using a Strongly Typed DataSet pptx

... method myDataTable.AddCustomersRow(myDataRow); // push the new row to the database using // the Update() method of sqlDataAdapter1 sqlDataAdapter1.Update(myDataTable); // find the row using the ... of myDataTable myDataRow = myDataTable.FindByCustomerID("J5COM"); myDataTable.RemoveCustomersRow(myDataRow); // push the delete to the database sqlDataAdapter1.Update(myDataTable); sqlConnection1.Close(); ... "1 Any Street"; // push the modification to the database sqlDataAdapter1.Update(myDataTable); // display the DataRow objects in myDataTable // in the listView1 object foreach (MyDataSet.CustomersRow...

Ngày tải lên: 24/12/2013, 01:17

3 300 0
Tài liệu Updating Server Data Using a Web Service pptx

Tài liệu Updating Server Data Using a Web Service pptx

... ORDERS_ORDERDETAILS_RELATION = "Order_OrderDetails_Relation"; // [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet ... UpdateOrders(DataSet ds) { // Create the DataAdapters for order and order details tables SqlDataAdapter daOrders = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["DataConnectString"]); ... DataSet to create a copy of the DataSet containing only the changes This DataSet is passed to the web service instead of the entire DataSet to minimize the bandwidth required to transmit data...

Ngày tải lên: 24/12/2013, 05:15

6 415 0
báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

... Reverse ACGCCAGTCTGACGAAGGTCCA COX-2 Forward CAGACAACATAAACTGCGCCTT Reverse GATACACCTCTCCACCAATGACC IL- 1a Forward TACTCGTCGGGAGGAGACGACTCT 107 bp NM_010554.4 interleukin alpha Reverse TCCTTCAGCAACACGGGCTGGT ... GCATGTGCGTTCCAGGCTAGCA Forward CAAGGGACAAGGCTGCCCCG 109 bp NM_013693.2 tumor necrosis factor alpha Reverse AAGTGCATCATCGTTGTTCATACA IL-12 P35 Forward GCATGCTGGTGGCCATCGATGA Reverse GCGTGAAGCAGGATGCAGAGCT ... Sequence Amplicon Size Assession# Name b-Actin Forward GGCTGTATTCCCCTCCATC 141 bp NM_007393.2 actin, beta, cytoplasmic ASF Reverse ATGCCATGTTCAATGGGGTA Forward CAGATCGCCTACGCCATGCAGA 81 bp NM_008951.1...

Ngày tải lên: 19/06/2014, 22:20

8 447 0
Báo cáo khoa hoc:" Estimating covariance functions for longitudinal data using a random regression model" potx

Báo cáo khoa hoc:" Estimating covariance functions for longitudinal data using a random regression model" potx

... recognized as a suitable alternative to the conventional multivariate mixed model to describe genetic and phenotypic variation for longitudinal data, i.e typically data with many, ’repeated’ measurements ... ’infinite-dimensional’ equivalent to covariance matrices in a traditional, ’finite’ multivariate analysis [15] As the name indicates, a covariance function (CF) describes the covariance between records taken at ... there are q records for animali and a total ofq different ages in the data Commonly, under a ’finite-dimensional’ model of analysis, data represented by equation (2) are analysed either assuming...

Ngày tải lên: 09/08/2014, 18:21

20 218 0
Using a DataGrid Control to Access a Database

Using a DataGrid Control to Access a Database

... Preview dialog box Next, you need to create a DataSet object You use a DataSet object to a store local copy of the information stored in the database A DataSet object can represent database structures ... Northwind database; you might need to get the password from your database administrator) Drill down to the Customers table in the Northwind database and drag it to your form This creates a SqlConnection ... contains DataSet1, as shown in Figure 6.15 Figure 6.15: Entering the DataSet details in the Generate Dataset dialog box Click the OK button to continue This adds a new DataSet object named dataSet11...

Ngày tải lên: 07/11/2013, 10:15

8 487 0
báo cáo hóa học:" Transparent SiON/Ag/SiON multilayer passivation grown on a flexible polyethersulfone substrate using a continuous roll-to-roll sputtering system" pot

báo cáo hóa học:" Transparent SiON/Ag/SiON multilayer passivation grown on a flexible polyethersulfone substrate using a continuous roll-to-roll sputtering system" pot

... substrate as a function of both top and bottom SiON thicknesses Due to the small size of the SiON/Ag/SiON multilayer samples, the WVTR values for all multilayer passivation were measured by packaging ... ion beam treatment at a DC-pulsed power of 100 W to enhance adhesion between the PES substrate and the bottom SiON layer After the ion beam treatment, the bottom SiON layer was sputtered (a) (b) ... sputtering was investigated as a function of the top and bottom SiON thickness The SiON/Ag/ SiON multilayer thin-film passivation on the PES substrate has a high transmittance of 87.7% and a low WVTR...

Ngày tải lên: 21/06/2014, 17:20

6 240 0
Báo cáo y học: " Airway management in simulated restricted access to a patient - can manikin-based studies provide relevant data" pptx

Báo cáo y học: " Airway management in simulated restricted access to a patient - can manikin-based studies provide relevant data" pptx

... this article as: Nakstad and Sandberg: Airway management in simulated restricted access to a patient - can manikin-based studies provide relevant data? Scandinavian Journal of Trauma, Resuscitation ... Evaluation of airway equipment: man or manikin? Anaesthesia 2011, 66(1):1-3 16 Asai T: Tracheal intubation with restricted access: a randomised comparison of the Pentax-Airway Scope and Macintosh laryngoscope ... typical setting for controlled prehospital airway management In scenario B, the manikins were placed on the ground abutting a wall, and access to the manikin head and airway was from the caudal...

Ngày tải lên: 13/08/2014, 23:20

5 194 0
ACCESS TO CREDIT OF ANIMAL PRODUCTION HOUSEHOLDS: A STUDY IN HAI DUONG PROVINCE, VIETNAM

ACCESS TO CREDIT OF ANIMAL PRODUCTION HOUSEHOLDS: A STUDY IN HAI DUONG PROVINCE, VIETNAM

... statistics and analysis of variance (ANOVA) F- test was used for mean comparison Animal production refers to poultry, breeding and fattening pig, and fish production 1051 Access to credit of animal ... legally be transferred, sold, leased, bequeathed and used as collateral for loans The duration of tenure rights was extended to 20 years for agricultural land and to 50 years for forest land and ... sector the later is considered as an external affecting factor to credit accessibility of farmers Assessment of farmers about the strengths and weaknesses of the formal sector in Hai Duong was...

Ngày tải lên: 28/08/2013, 09:18

11 500 0
Using a SqlConnection Object to Connect to a SQL Server Database phần 1

Using a SqlConnection Object to Connect to a SQL Server Database phần 1

... ADO.NET automatically stores database connections in a pool Connection pooling offers a great performance improvement because you don't have to wait for a brand new connection to the database to be ... Server database */ using System; using System .Data; using System .Data. SqlClient; class MySqlConnection { public static void Main() { // formulate a string containing the details of the // database ... */ using System; using System .Data; using System .Data. SqlClient; class ConnectionPooling { public static void Main() { // create a SqlConnection object to connect to the database, // setting max...

Ngày tải lên: 07/11/2013, 10:15

7 730 0
Tài liệu Module 3: Using a Conceptual Design for Data Requirements docx

Tài liệu Module 3: Using a Conceptual Design for Data Requirements docx

... The logical and physical implementation of a database necessitates that the data requirements be defined What types of data (at a high level) are going to be stored? " Explicit The data requirements ... know to perform a function or task Each functional data requirement is directly traceable to an actor and an object within a use case Nonfunctional data requirements A nonfunctional data requirement ... solution is a necessary first step in determining the solution’s overall data design If a solution has no data requirements, it has no need for data storage, let alone a logical data organization Determining...

Ngày tải lên: 10/12/2013, 17:15

20 581 0
Tài liệu Using a SqlConnection Object to Connect to a SQL Server Database phần 2 doc

Tài liệu Using a SqlConnection Object to Connect to a SQL Server Database phần 2 doc

... SqlConnection("server=localhost ;database= Northwind;uid=sa;pwd=sa"); // monitor the StateChange event using the StateChangeHandler() method mySqlConnection.StateChange += new StateChangeEventHandler(StateChangeHandler); ... illustrates the use of the StateChange event Listing 7.3: STATECHANGE.CS /* StateChange.cs illustrates how to use the StateChange event */ using System; using System .Data; using System .Data. SqlClient; ... state of the connection to the database The State property returns a constant from the ConnectionState enumeration Note An enumeration is a list of numeric constants, each of which has a name...

Ngày tải lên: 14/12/2013, 13:15

7 595 0
Tài liệu Using Transaction Isolation Levels to Protect Data doc

Tài liệu Using Transaction Isolation Levels to Protect Data doc

... // Create a DataAdapter to retrieve all Orders SqlDataAdapter da = new SqlDataAdapter(cmd); // Define a CommandBuilder for the DataAdapter SqlCommandBuilder cb = new SqlCommandBuilder(da); // ... Fill table with Orders DataTable dt = new DataTable( ); da.Fill(dt); // Bind the default view of the table to the grid dataGrid.DataSource = dt.DefaultView; cancelButton.Enabled = true; dataGrid.ReadOnly ... made resulting in the second transaction having invalid data Inconsistent Analysis A second transaction reads different data each time that the same (Nonrepeatable row is read Another transaction...

Ngày tải lên: 14/12/2013, 18:16

5 419 0
Tài liệu Using a DataView to Control Edits, Deletions, or Additions in Windows Forms pdf

Tài liệu Using a DataView to Control Edits, Deletions, or Additions in Windows Forms pdf

... adding, editing, or deleting the data in the control Binding a DataGrid to a DataTable binds to the default view of the underlying DataTable The DataView class represents a view of the DataTable ... using System .Data; using System .Data. SqlClient; private DataView dv; // private void ControlDataEditWithDataViewForm_Load(object sender, System.EventArgs e) { // Fill the Order table SqlDataAdapter ... SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable dtOrders = new DataTable("Orders"); da.FillSchema(dtOrders, SchemaType.Source);...

Ngày tải lên: 14/12/2013, 18:16

3 533 0
Tài liệu Module 9: Using XML to Exchange Data pptx

Tài liệu Module 9: Using XML to Exchange Data pptx

... BookListSchema.xml One advantage of associating schemas with namespaces is that different schemas can be applied to different parts of the document A schema can be associated with a namespace alias and all ... http://msdn.microsoft.com/xml/general/soapspec-v1.asp Module 9: Using XML to Exchange Data ! 17 ActiveX® Data Objects (ADO version 2.0 and above) ADO recordsets can be persisted in an XML format This advantage allows them to ... flexibility of XML has increased dramatically because two organizations simply need to agree to a common XML grammar to start the exchange of data ! Standardization of documents Many professionals in industry,...

Ngày tải lên: 21/12/2013, 19:15

80 492 0
Tài liệu Instructor Notes Module 3: Using a Conceptual Design for Data Requirements pdf

Tài liệu Instructor Notes Module 3: Using a Conceptual Design for Data Requirements pdf

... be able to: • Discuss use cases, data requirements, and requirements validation as they relate to conceptual design for data systems ! To prepare for the activity • Review the activity and anticipate ... difficult to identify Many students with database backgrounds will want to think and work in the physical data model Remind them that, at this point, the work is still in the conceptual phase THIS PAGE ... 2 Instructor Notes Module 3: Using a Conceptual Design for Data Requirements Activities Activity 3.1: Identifying Data- Related Use Cases and Data Requirements In this activity, students...

Ngày tải lên: 17/01/2014, 09:20

4 448 0
Tài liệu Cisco Remote Access to MPLS VPN Integration 2.0 Overview and Provisioning Guide doc

Tài liệu Cisco Remote Access to MPLS VPN Integration 2.0 Overview and Provisioning Guide doc

... the Customer Cable Access Router 5-18 APPENDIX A AAA Radius Access to MPLS VPN Integration A- 1 AAA Radius Requirements A- 1 AAA Radius Event Sequence A- 1 Authorization at the NAS A- 2 Tunnel Authentication ... merkitsee vaaraa Olet tilanteessa, joka voi johtaa ruumiinvammaan Ennen kuin tyửskentelet minkọọn laitteiston parissa, ota selvọọ sọhkửkytkentửihin liittyvistọ vaaroista ja tavanomaisista onnettomuuksien ... central database system might dial out nightly to remote vending machines to collect daily sales data and check inventories In this release of Cisco Remote Access to MPLS VPN integration, the dialer...

Ngày tải lên: 18/01/2014, 05:20

176 394 0
Tài liệu Using a Single Stored Procedure to Update Multiple Changes to a SQL Server Database pdf

Tài liệu Using a Single Stored Procedure to Update Multiple Changes to a SQL Server Database pdf

... System.EventArgs e) { ds = new DataSet( ); // Create the DataAdapter SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME, ConfigurationSettings.AppSettings["Sql_ConnectString"]); // Load ... schema and data for the table da.FillSchema(ds, SchemaType.Source, TABLENAME); da.Fill(ds, TABLENAME); // Columns in XML representation of data as attributes foreach(DataColumn col in ds.Tables[TABLENAME].Columns) ... StringWriter(sb); ds.GetChanges( DataRowState.Added | DataRowState.Modified).WriteXml(sw, XmlWriteMode.WriteSchema); cmd.Parameters.Add(" @data" , SqlDbType.NText); cmd.Parameters[" @data" ].Value = sb.ToString(...

Ngày tải lên: 21/01/2014, 11:20

7 444 0
w