transforming a dataset using xslt

... tables The XML schema and data for the DataSet is written both to a file and to a text box on the form Read Button.Click Creates a DataSet and reads in schema and data from a file containing a ... adding new tables and columns as required ReadSchema Reads any inline schema and loads the data into the DataSet If the DataSet already contains tables, new tables will be added but an exception ... private void writeXmlButton_Click(object sender, System.EventArgs e) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT

Ngày tải lên: 24/12/2013, 05:15

... Trang 1How to Build a ServiceUsing GT4 Globus Alliance Staff Rachana Ananthakrishnan, Charles Bacon, Lisa Childers, Jarek Gawor, Joe Insley, Argonne National Laboratory Ben Clifford, ... and GT4  Build a Service  1 Getting Started: Deploy a Service  2 State Management Part I: Create Resources  3 Lifetime Management Part I: Destroy Resources  4 State Management Part II: Add ... and GT4  Build a Service  1 Getting Started: Deploy a Service  2 State Management Part I: Create Resources  3 Lifetime Management Part I: Destroy Resources  4 State Management Part II: Add

Ngày tải lên: 07/01/2014, 01:19

... Trang 1[ Team LiB ]Recipe 4.10 Updating a DataSet with a Many-to-Many Relationship Problem You have a DataSet that contains two tables that have a many-to-many relationship between them using ... creating a DataSet containing a parent, Trang 3child, and many-to-many junction table, as well as the DataRelation objects between them A DataAdapter object is created for each table and the stored ... System.Data; using System.Data.SqlClient; private DataSet ds; private SqlDataAdapter daParent, daParentChild, daChild; private const String PARENTTABLENAME = "TBL0410Parent"; private const

Ngày tải lên: 26/01/2014, 10:20

... twelve African Americans played on the professionaltour A decade after Tiger Woods turned professional, he remains theonly African American player on the PGA tour Not a single AfricanAmerican woman ... China and South Korea Today it’s a global passion, withprofessionals from all over the world Although Americans dominatejunior tournaments, Europeans and Asians are increasingly visible atAJGA ... the Year, agreed to become theorganization’s first honorary chairman “Watson was a real gentleman, a smart guy, an academic, and he saw the need,” Bentley recalls fessional Golf Association Tour

Ngày tải lên: 08/03/2014, 20:20

... Modifying Administrative Distance distance eigrp internal-distance external-distance Router(config-router)#  Used for EIGRP Trang 48Update TrafficTrang 49Using the passive-interface CommandTrang 50Using ... the matching routes Trang 63The match commandsone of the interfaces specified match ip address Matches any routes that have a destination network number address that is permitted by a standard ... packets that pass a match clause of a route map for policy routing set ip default next-hop Indicates where to output packets that pass a match clause of a route map for policy routing and for

Ngày tải lên: 06/07/2014, 23:21

... survey using the theory of planned behaviour Tiina Kortteisto*1, Minna Kaila1,2, Jorma Komulainen3,4, Taina Mäntyranta5 and Pekka Rissanen1 Abstract Background: Finnish clinical guidelines are evolving ... the data collection We are grateful also to Adjunct Professor Anna-Mari Aalto from the National Insti-tute for Health and Welfare, who participated in designing the questionnaire; to assistants ... coefficient, was above 0.8 for each of these variables, which can be considered a satisfactory value [43] Profession group differences for the intention variable were analysed via variance analysis

Ngày tải lên: 10/08/2014, 10:23

... data and literature data of Antharacene at 20oC 52 Table 14: Comparison between experimental data and literature data of Naphthalene at Trang 9Table 22: Accuracy of experimental values for components ... hydrocarbons including Paraffin and Branched-Chain Paraffin Hydrocarbons, Olefin Hydrocarbons, Acetylene Hydrocarbons, Cycloparaffin, Cycloolefin, and Aromatic Hydrocarbons by using a gas-liquid partition ... for Waste Management and Contaminated Site Treatment – TU Dresden - German Academic Exchange Service (DAAD) Warmly thanks to Mai, Christian, Hai Minh for your help Thanks to all my colleagues

Ngày tải lên: 03/11/2015, 14:21

... sediment), and burned of open area The appearance of open area for mining is classed as mining class, meanwhile, open area that is the example of land clearing classed as open area class Open area in ... geographic data The spatial data for research are imageries from land sat Land sat is series of satellite for earth resource observation such as land and forest The first land sat had been launched ... has greatly increased and research on land use/land cover change thus providing an accurate evaluation of the spread and health of the world’s forest, grassland, and agricultural land use has

Ngày tải lên: 18/11/2020, 14:00

... of Wave – Wind Interaction at a Seawall Using a Numerical Wave Channel Phung Dang Hieu 1* , Phan Ngoc Vinh2, Du Van Toan1, Nguyen Thanh Son3 Faculty of Hydro-Meteorology and Oceanography, Hanoi ... was 0.42 The water surface elevation at some locations was measured by using the capacitance wave gauges The overtopping water volume was measured wave by wave by capturing the overtopped water ... comparison Fig 3 shows the comparison of water surface elevations between simulated results and laboratory data at the wave gauges G1 and G4 After about seven wave periods, good Trang 12 agreements

Ngày tải lên: 14/12/2017, 15:56

... consideration of many studies Neuraminidase (NA) (also known as sialidase), a viral enzyme that play a key role in the life cycle of influenza viruses, would be the main stream of pharmacological strategies ... experimental ∆Gexp (Fig S2), and the parameters in parabola functions for free energy surfaces around bound states (Table S1) are also provided This material is available free of charge via the internet ... steered molecular dynamics (SMD) and the average electrostatic potential More accurate binding affinities of drug candidates are needed for rational drug design against H5N1 variants The free

Ngày tải lên: 16/12/2017, 08:29

... duration) characterise a telephone call in which a particular caller (i) selects a number to call, (ii) initiates a call and (iii) terminates the call In neither case is any information available ... bioenergetics, mathematical analysis and science education After completing a PhD at the Australian National University, he taught and carried out research at universities in the United Kingdom, New Zealand ... Institute, Australia Wei-Hang Chua Margreet Hekman Matthew T Levin Massey University, New Zealand Simon Brown Deviot Institute, Australia James Cook University, Australia Knowledge Management &

Ngày tải lên: 10/01/2020, 08:42

... GCCCGTTGAGCCCACAGAATCTAC GGAAGAGGTGGCCAAAATGAAGAG TI MP-1 NM_213857.1 CCTGACATCCGGTTCATCTA CAGTTGTCCAGCTATGAGAAAC TIMP-3 XM_003126073.4 GGATTGTGTAACTTTGTGGAGAG GGCAGGTAGTAGCAGGATTTA Figure 1 Schematic of bioreactor ... AGTCCACTGAGATCCTCTACTC Collagen II XM_001925959.4 CCGGGTGAACGTGGAGAGACTG CGCCCCCACAGTGCCCTC ADAMTs-4 XM_003481414.2 TTCAACGCCACGTTCTACTC GCCGGGATGATGAGGTTATTT MMP-3 NM_001166308.1 GCCCGTTGAGCCCACAGAATCTAC ... target genes Gene Accession number Forward (5’-3’) Reverse (5’-3’) GAPDH NM_001206359.1 ACCTCCACTACATGGTCTACA ATGACAAGCTTCCCGTTCTC Aggrecan NM_001164652.1 CGTGGTCCAGCACTTCTAAA AGTCCACTGAGATCCTCTACTC

Ngày tải lên: 15/01/2020, 21:59

... Medicaid, 39 Medicare, 36–37 AHA (American Hospital Association), 7, 231 Allegis, 219 Alternative payment models (APMs), 48, 169, 172 gainsharing, 48 shared savings, 48–49 AMA (American Medical Association), ... Affordable Care Act (ACA) Academic health system, 109–110 Accountable Care Organizations (ACOs), 48–50, 199, 231 Actuarial value, 43, 111 Acute Care for Elders (ACE) units, 186 Addiction treatment, ... Association), 119, 200, 225–226 AMA Masterfile, 58 Amazon, health care in, 123 239 240 ◾ Index American Hospital Association (AHA), 7, 231 American Medical Association (AMA), 119, 200, 225–226 Ameriplan,

Ngày tải lên: 17/01/2020, 15:05

... options We can have a purchase and consumer market that is tatively informed, and that is able to make rational choices on the basis of measureable, comparable value We can pave the way for a competitive ... with the ACA exchanges and Medicaid expansions—of a significant number of Americans who don’t have affordable access to health care And many others who are exposed to the consequences of catastrophic ... overhaul the outdated financing, deliv-ery, and regulatory structures that exist today With this trans-formation we can have a market-driven market with expanded safety nets, affordable access, and

Ngày tải lên: 20/01/2020, 12:55

... Medicaid, 39 Medicare, 36–37 AHA (American Hospital Association), 7, 231 Allegis, 219 Alternative payment models (APMs), 48, 169, 172 gainsharing, 48 shared savings, 48–49 AMA (American Medical Association), ... Affordable Care Act (ACA) Academic health system, 109–110 Accountable Care Organizations (ACOs), 48–50, 199, 231 Actuarial value, 43, 111 Acute Care for Elders (ACE) units, 186 Addiction treatment, ... Association), 119, 200, 225–226 AMA Masterfile, 58 Amazon, health care in, 123 239 240 ◾ Index American Hospital Association (AHA), 7, 231 American Medical Association (AMA), 119, 200, 225–226 Ameriplan,

Ngày tải lên: 02/03/2020, 16:50

... contaminant transport in variably saturated media with additional simulation and parameter estimation tools, data sources for the simulation and a graphical user interface The computer-based decision ... software is revised to adapt with not only all available data but also a few available data The lysimeter is good for calibrating the model and will be better if the data is documented well and ... Sciences and Institute for Waste Management and Con- taminated Site Treatment (IAA) for providing all materials and equipments that I used during the course  Vietnam National University, Hanoi and

Ngày tải lên: 20/11/2020, 08:44

... theoretically guaranteed for accuracy The imple-mentation of CoMet and evaluations were carried out in R and relevant files are available at https://github.com/ damayanthiHerath/comet Comparison ... https://data.cami-challenge.org/ Mentioned dataset that was downloaded from CAMI is referred as sim30_cami Evaluation of CoMet on strain datasets with varying coverage distributions The effect of varying ... binning performances of CoMet and Metawatt, MaxBin, MyCC (default) and MyCC (coverage) were eval-uated using four simulated benchmark datasets Simulated Illumina sequences of a metagenomic sam-ple comprising

Ngày tải lên: 25/11/2020, 16:39

... for Waste Management and Contaminated Site Treatment Hanoi - 2008 ® Trang 2ACKNOWLEDGEMENTS Two years have passed and marked a historical pathway toward my Master degree The two years were ... for a wide variety of contaminants if the software is revised to adapt with not only all available data but also a few available data The lysimeter is good for calibrating the model and will be ... groundwater after infiltration has ceased Evapotranspiration (ET): Evaporation and Transpiration Evaporation (E) is the water loss from bare soil or a free water surface to the atmosphere and

Ngày tải lên: 05/12/2020, 19:48

... students originally come from: Japan (JAP), East Asia excluding Japan (EA), South Asia (EA), South East Asia (SEA) or other regions (Others) Female 170 63.43% Academic The current academic level ... certain limitations and implications of the dataset 2 Data Description The dataset comprises of 268 records from both international and domestic students in an international university in Japan ... three variables “Intimate”, “Internet_bi”, and “Internet” should be used with caution The data was anonymized using Microsoft Excel and later saved as a CSV file (See the dataset) Eventually, all

Ngày tải lên: 14/12/2021, 18:54

... numerical modeling of water flow and contaminant transport in variably saturated media with additional simulation and parameter estimation tools, data sources for the simula-tion and a graphical ... for a wide variety of contaminants if the software is revised to adapt with not only all available data but also a few available data The lysimeter is good for calibrating the model and will be ... percolation (and can cause a higher wa-ter table and salinization of soil) and evapotranspiration, see below (Marshall T.J et al., 1996, p 268-271) Surface Runoff or Overland Flow (A) In case that

Ngày tải lên: 13/07/2022, 16:09