... et al. 2838 FEBS Journal 274 (2007) 2832–2842 ª 2007 The Authors Journal compilation ª 2007 FEBS GTCACCTGGTAGTTACTGCCGCCGAAG-3¢,5¢-CGAC GATCTCAAT AACTTGATGATTTCAGG-3¢ and 5¢-CTC CTGAAATCATCAA GTTATTGAGATCGTCG-3¢, ... share structural and functional characteristics, including a catalytic triad, an a ⁄ b- hydrolase fold and a cofactor independent activity. The catalytic triad usually consists of a nucleophilic serine ... Hirooka K, Shimanuki S, Yokota Y, Hemmi H, Nakayama T & Nishino T (2004) Molecular cloning and characterization of a thermo- stable carboxylesterase from an archaeon, Sulfolobus shibatae DSM5389:
Ngày tải lên: 23/03/2014, 09:20
... and Ganu Subramanian. Production and dissemination of WIR12 was supported by Elisabeth Anodeau-Mareschal, Severine Excofer, Rosalina Goyena, Natalia Meramo-Bachayani and Katia Vieu. The manuscript ... from the advice of Lorraine Eden, Arvind Mayaram, Ted Moran, Rajneesh Narula, Karl Sauvant and Pierre Sauvé. Bradley Boicourt and Lizanne Martinez provided research and statistical assistance. ... in the tables: • Two dots ( ) indicate that data are not available or are not separately reported. Rows in tables have been omitted in those cases where no data are available for any of the
Ngày tải lên: 30/03/2014, 12:20
Recruitment process outsourcing a new type of service provider
... Model of Human Resource Strategy that has competitive advantages in change management (Kalyani and Shahoo, 2011) 4 Modified Miaoulis et al (2008) stages of recruitment 5 Theoretical framework applied ... of categorization, secondary tools have to do with management of CV, career fairs and niche information whereas auxiliary tools included newsletter Generally it appears that organisations can ... The operational side is a set of goals related to detailed process that does not necessarily to add extra value to the process but are still crucial An example of this in the case of a payroll
Ngày tải lên: 26/04/2020, 22:01
How swelling debts give rise to a new type of politics in vietnam
... growth equals a rapid accumulation of debts State media reported that the amount of NPLs started stacking up from 2007 but only Trang 17on the ratio of NPLs against outstanding loans at banks, but ... case of incomplete rural credit markets, Stampini & Davis (2009) show that participation in non-agricultural labor may help relax credit constraints and provide cash for market purchases of ... access to credit Where informal and semi-formal lenders lead Rural credit Official data show that 65.49% of Vietnam’s population of nearly 93 million live in the rural areas and depend on agriculture
Ngày tải lên: 29/07/2022, 11:04
Towards a new generation of participatory approach to integrated natural resource management experience of the SAMBA role play in vietnam uplands
... Trang 1Towards a new generation of participatory approach to integrated natural resource management: experience of the SAMBA role-play in Vietnam uplands Jean-Christophe Castella Institut ... households make decisions about land use and labor allocation At the start of play, players are assigned families and paddy-land holdings of various sizes Researchers record the outcome of the game, and ... other participatory approaches to natural resources management In the mountainous areas of Vietnam, traditional methods for land use system analysis and farmers’ need assessment are challenged by
Ngày tải lên: 18/10/2022, 18:11
extensive testing and comparison of a new type of target for use in engineering surveying
... of the assumed and measurement accuracy achieved The a priori standard deviation was selected as a value of 1 The a posteriori standard deviation reached a value of 0.94 after the network adjustment, ... comparison of the spatial coordinates. Type of target collimator (rotated)Target with Target with collimator (non-rotated) Reflective sheet Tab 4 Standard deviations calculated from a comparison of ... in Tab 3 for comparing the coordinates of the spatial variations in Tab 4 for a comparison of the lengths Trang 8According to the size of the standard deviations in Tables 3 and 4, it can be argued
Ngày tải lên: 24/11/2022, 17:56
Five Year Strategic Plan (2011-2016) - Towards a New Dawn Ministry of Women and Child Development Government of India potx
... IGMSY Indira Gandhi Matritva Sahyog Yojana IMNCI Integrated Management of Neonatal and Childhood Illness IMR Infant Mortality Rate INGO International Non Government Organisation IYCF Infant and Young ... access to education and health care, and lack of livelihood options are some of its underlying causes MWCD has adopted a multi pronged approach to prevent and combat trafficking Ujjawala, a comprehensive ... expansion across the country 7.2 The Indira Gandhi Matritva Sahyog Yojana aims to improve the health and nutrition status of pregnant, lactating women and infants by the promotion of appropriate practices,
Ngày tải lên: 23/03/2014, 06:20
Beyond the particular case of circuits with geometrically distributed components for approximation of fractional order models: Application to a new class of model for power law type long
... distributions (an infinity exist) of parameters that also lead to the same kind of behaviour As a Cauer type network can be obtained through the discretisation of a heat equation, Sec-tion ‘Heat equaSec-tion ... diagrams of the approximation Hað Þ obtained by discreti-s sation of integral(38)and change of variable(37) are shown in Fig 6 They are compared with the Bode diagrams obtained with change of variable ... comparison reveals that the two changes of variable are of equivalent quality with the same com-plexity (N¼ 10) As an infinity of changes of variable can be proposed, an infinity of Foster type
Ngày tải lên: 27/09/2020, 15:03
A New Map of Hollywood: The Production and Distribution of American Motion Pictures pot
... specifications of each particular job, or batch of jobs, that they concentrate on making a narrow range of outputs in comparatively limited quantities, and in are different from all preceding jobs A ... geographic base has been the arena of many and The basic argument set forth by these two authors perplexing transformations over the last few decades revolves around the transformation of the classical ... follows that a more accurate portrayal of Hollywood today involves With the reconstitution of the production system as a transactions-intensive congeries of small and specialized acknowledgment of the
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx
... (amylopullulanases) or at the N-term-inal end (6-a-glucosyltransferase and 4-a-glucanotrans-ferases) Interestingly, a-glucan water dikinase, a starch phosphorylating enzyme from Arabidopsis thaliana, ... the catalytic domain [8–10], while the catalytic domain in GH15 (glucoamylases) is a helical (a⁄ a)6-barrel fold [11] The structure of a GH57 4-a-glucanotransferase was recently determined as a ... Certain amylolytic enzymes have this capacity without the presence of a specialized functional domain [15–17], but these are few One example is the barley a-amylase that binds to raw starch at a
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... quantity of b-actin in the same sample Table 1 The oligonucleotides used in this work. TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA TGATCTCTTGAACAAATTACTTACACAAAGAG Trang 10Western blotHCC cells were transfected ... acquisition and analysis software was used to quan-tify band intensities Antibodies were purchased from Tian-jin Saier Biotech and Sigma-Aldrich Statistical analysis Data are expressed as mean ... phosphatase 6 catalytic subunit; SD, standard deviation; shRNA, small hairpin RNA; siRNA, small interfering RNA. Trang 2are important for target site recognition, and they havebeen designated as
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: "Towards a proper treatment of coercion phenomena" potx
... para- phrase, and the type that the argument has outside *We are indebted to Anne Abeilld, Nicolas Asher, Michel Aurnague, Andrde Borillo, Annie Delaveau, Jean Marie Marandin, Jean-Pierre Mantel, ... transit ionl) of_type (TRANSITION, trans it ion1 ) STARTS (transitionl ,statel) ENDS (trans itionl, star e2) of_type (STATE, star e I ) of_type (STATE, star e2) CARRIER(statel, j) CARRIER(state2, ... telic/atelic as a predicate of predicates; the lat- ter have objects as well as events in their domains, and, linguistically, they are nominal as well as ver- bal predicates In the same way we
Ngày tải lên: 18/03/2014, 02:20
13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt
... MAR-J1, MZ carbonate and Sigma-carb standards made between Janu-ary, 2004 and April, 2005 Each data point represents the average of between 1 and 10 analyses of the gas from a sin-gle acid extraction ... IAEA) and three intra-laboratory calcite standards, MARJ-1, MZ carbonate and Sigma-carb Two of the standards (NBS-19 and MARJ-1) were purified from Italian Carrara marbles that were metamor-phosed ... current of 160 nA Each analysis in-volves 10 cycles of sample-standard comparison and each cycle involves 8 s integration of sample and standard ion beams Analyses were standardized by comparison
Ngày tải lên: 22/03/2014, 18:20
Đề tài " A new application of random matrices: Ext(C red(F2)) is not a group " ppt
... unital nuclear C ∗-algebra and by Voiculescu [V1], Ext(A) is a unital semi-group for all separable unital C ∗-algebras A Anderson [An] provided in 1978 the first example of a unital C ∗-algebraA ... first example of a C ∗-algebra A for which Ext(A) is not a group. 1 Introduction A random matrix X is a matrix whose entries are real or complex dom variables on a probability space (Ω, F, P ) As ... consisting of a unital C ∗-algebra B and a state τ on B. b) A family of elements (a i)i ∈I in a C ∗-probability space (B, τ) is free if for all n ∈ N and all polynomials p1, , p n ∈ C[X], one has
Ngày tải lên: 22/03/2014, 20:20
TOWARDS A COMPREHENSIVE APPROACH OF SEXUAL AND REPRODUCTIVE RIGHTS AND NEEDS OF WOMEN DISPLACED BY WAR AND ARMED CONFLICT pptx
... considered2: 2 OJEDA Gabriel, MURAD Rocío, Salud Sexual y Reproductiva en Zonas Marginales Situación de las Mujeres Desplazadas.”, Asociación Probienestar de la Familia Colombiana PROFAMILIA, Bogotá, ... acomprehensive approach of SRH still constitutes a real challenge for donors,international humanitarian agencies, national authorities, national and internationalnon-governmental organizations, and community ... - Participation and role of the counterpart in thesemechanisms Trang 17- Participation of national NGOs and authorities.- Participation of national women’s and human rightsorganizations - Participation
Ngày tải lên: 28/03/2014, 14:20
Đề tài " A new construction of the moonshine vertex operator algebra over the real number field " pot
... Annals of Mathematics A new construction of the moonshine vertex operator algebra over the real number field By Masahiko Miyamoto Annals of Mathematics, 159 (2004), 535–596 A new ... [DMZ] that V is a framed VOA of rank 24. Our main purpose in this paper is to reconstruct V as a framed VOA. Another important example of framed VOAs is a code VOA M D for an even linear code ... {e 1 , ,e n } of conformal vectors “a coordinate set.” We note that a VOA V of rank n 2 is a framed VOA if and only if V is a VOA containing L( 1 2 , 0) ⊗n as a sub VOA with the same Virasoro element.
Ngày tải lên: 28/03/2014, 22:20
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx
... 5¢-ATGGTAGGTCTCAAATGATAGGAA ATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev, 5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA TTTTTTGC-3¢. The gene mm0632 was cloned via BsaI restriction sites in plasmid pASK-IBA3 (IBA GmbH, Go ¨ ttingen, ... [7]. Methanosarcina mazei is one of the methanogenic archaeons, which are characterized by the ability to generate methane as the major end product of energy metabolism [8]. Many Methanosarcina strains ... structure of a monofunctional catalase from Methanosarcina barkeri. Arch Microbiol 171, 317–323. 39 Brioukhanov A, Netrusov A, Sordel M, Thauer RK & Shima S (2000) Protection of Methanosarcina barkeri against
Ngày tải lên: 28/03/2014, 23:20
Towards a safer use of the Internet for children in the EU – a parents’ perspective ppt
... least likely to use it at least daily (between 27% and 38%) although parents in Latvia, Lithuania, Bulgaria, Slovenia and Slovakia were less likely than those in Germany, Ireland and Austria ... than their counterparts in rural areas: 79% of parents in metropolitan areas and 76% of those in urban areas said their child used the Internet compared to 72% of parents in rural areas Finally, ... Internet at least once a day (32%) or several times a day (22%) An additional 16% of the parents went online several times a week and 6% at least once a week Only a minority said they were occasional
Ngày tải lên: 29/03/2014, 19:20
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
... growth factors and proteinase inhibitors. Biol Chem 380, 473–483. 17 Kataoka H, Uchino H, Asada Y, Hatakeyama K, Nabeshima K, Sumiyoshi A & Koono M (1997) Analy- sis of tissue factor and tissue ... that the SEA domain functions by orienting the active site cleft of DESC1 toward plasma and ⁄ or extracellular spaces and away from the cell surface and ⁄ or the extracellular matrix. The SEA ... media for enzymatic activity against Spectrozyme t-PA (CH 3 SO 2 -D-HHT-Gly-Arg-pNA*HCl; American Diagnostica, Stanford, CT, USA). Details of the expression and purification of multimilli- gram amounts...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Toward a New Literacy of Cooperation in Business MANAGING DILEMMAS IN THE 21ST CENTURY pdf
... level of trust, extent of role specialization, level of coordination or manage- ment, and level of feedback and information avail- able. When certain levels are reached among these variables, new ... FUTURE 3 Social Dilemmas: The Problem of the One and the Many Peter Kollock, author of Social Dilemmas: The Anatomy of Cooperation, explains that, Social dilemmas are situations in which individual rationality ... responsibilities, career paths, and training and professional development change in a more dynamic organizational structure? STRUCTURE: STATIC DYNAMIC 15 religious systems act as adaptive organisms. Moral...
Ngày tải lên: 18/02/2014, 00:20
Bạn có muốn tìm thêm với từ khóa: