tibetan herders in a globalizing world

... Cataloging-in-Publication Data Cities in a globalizing world : governance, performance and sustainability / edited by Frannie Léautier. p cm.—(WBI learning resources series) Includes bibliographical ... is adapted from Governance and the City, by Daniel Kaufmann, Frannie Léautier, and Massimo Mastruzzi, published in 2005 as Policy Research Working Paper 3712 (Washington, DC: World Bank). Library ... Perspectives on Globalization of Infrastructure, by Frannie Léautier and Andrew C Lemer, published in 2003 as a World Bank Institute Working Paper (Washington, DC: World Bank). Chương 3, “Toàn...

Ngày tải lên: 29/03/2018, 11:40

... British and U.S imperial frontiers Finally, each of Britain’s major settler colonies (Australia, Canada, New Zealand, and South Africa) went through a process of statemaking and regional political adjustment ... iron in Germany and the subjugation of the Taiping state in China, a movement that liberals in the United States and Britain saw as a kindred spirit and whose defeat destroyed a last viable effort ... Pomeranz’s sweeping reinterpretation of the rise of the West as a contingent outcome of what were parallel achievements in East Asia and Western Europe, China and East Asia have attracted the attention...

Ngày tải lên: 20/01/2020, 09:57

... British and U.S imperial frontiers Finally, each of Britain’s major settler colonies (Australia, Canada, New Zealand, and South Africa) went through a process of statemaking and regional political adjustment ... iron in Germany and the subjugation of the Taiping state in China, a movement that liberals in the United States and Britain saw as a kindred spirit and whose defeat destroyed a last viable effort ... Pomeranz’s sweeping reinterpretation of the rise of the West as a contingent outcome of what were parallel achievements in East Asia and Western Europe, China and East Asia have attracted the attention...

Ngày tải lên: 03/03/2020, 10:44

... in China: A Narrative Study of NBA Fans Fuhua Huang 115 vi Chapter Chapter Contents An Intra-Country Comparison of Chinese Business Leaders’ Personal Values Yuhui Gao 137 Mother-In-Law and Daughter-In-Law ... LCSH: Social change China | Social change Japan | Social change Korea (South) | Communication Social aspects China | Communication Social aspects Japan | Communication Social aspects Korea (South) ... Series tab Additional eBooks in this series can be found on Nova’s website under the e-book tab ASIAN STUDIES CONFLICT AND COMMUNICATION A CHANGING ASIA IN A GLOBALIZING WORLD SOCIAL AND POLITICAL...

Ngày tải lên: 14/09/2020, 16:04

... has been largely applied in socialcommunications and also in teaching and learning, has stimulated rote learning (Doa˜n 1999) These Confucian values do not all align with those espoused by adherents ... documentation includes: instructional aims,instructional phases which are constructed by functions, activities of teaching and/orlearning, and educational expectations Learning aims are necessary ... strategic and defined as instructional theories that are prescriptive in nature and were set up for atransition between the learning phases and learning settings In this study, the learningsetting...

Ngày tải lên: 20/02/2021, 08:32

... the American (AAA) and European (EAA) Accounting Associations, including as President of the AAA Management Section; the AAA Finance Committee; the EAA Doctoral Colloquium; and the EAA Publications ... Wim has published extensively in both practitioner and academic journals and has won several awards, including the AAA Notable Contribution to Management Accounting Literature and IFAC’s Article ... pushed by globalisation and the economic rise of Asia, is also forcing financial professionals to re-examine their roles Chinese and Indian companies in particular have gained global prominence while...

Ngày tải lên: 27/01/2014, 10:50

... despite easing in India in early 2012, with inflation picking up to a more-than 10 per-cent annualized quarterly pace in India, Pakistan and Sri Lanka by April 2012 In Sub-Saharan Africa, high-frequency ... (saar) Trang 14Box 1 Data suggest a pickup in activity in all regions following a weak second half of 2011 Industrial activity in East Asia & Pacific has accelerated sharply, and was growing ... Russia weakened In South Asia data was suggesting a sharp acceleration in Indian industrial production in the earlier part of 2012, apparently reflecting sharp increases in food and beverages output,...

Ngày tải lên: 06/03/2014, 09:22

...  James Taylor, Fair, Isaac & Co.  Allan Kolber, Inferware  Markus Schacher, KnowGravity Inc.  Antoine Lonjon, MEGA International  Cory Casanave, Model Driven Solutions  Ed Barkmeyer, ... metamodel, and the views of it used as diagrams in this document, were maintained in Macromedia Fireworks. Participants in Release 1.3 Co-Editors:  Keri Anderson Healy, Automated Reasoning ... are associated in a structure that is methodology-neutral; it will support a range of approaches for creating and maintaining a Business Motivation Model for an enterprise, and...

Ngày tải lên: 15/03/2014, 21:20

... agricultural or industrial Agriculture in India, sub-Saharan Africa, and Asia (excluding China) is forecast to create the most additional water demand to 2030 In China, industrial demand for water ... prompting a massive surge in aquaculture, especially in Asia.17 Soil erosion has been taking place at several times the natural replacement rate, the amount of available arable land per person has ... The financial crisis accelerated the shift of economic, financial and political power toward the developing world, in particular to dynamic emerging market nations such as China, India and Brazil...

Ngày tải lên: 15/03/2014, 21:20

... international taxproblems Many colleagues have made fairly useful comments about my articles I wish to thank the late Aldo Chiancone, as well asGianni Amisano, Antonio Guccione, Vesa Kanniainen, AlessandroMissale, ... (1964) articles on comprehensive income taxation Assuming that all kinds of capital are subject to the same marginal tax rate, they find that the value of an ment project is unaected by taxation ... option value of the project.7 In two interesting papers, Alvarez and Kanniainen (1997, 1998)analyzed the Johansson-Samuelson Theorem8 in a real-option set-ting They showed that as long as taxation...

Ngày tải lên: 16/03/2014, 14:20

... incomes, social class, in general, psychographics and demographics, assume, in the final analysis, a certain stability or largely predictable change After all, one’s demographic and psychographic ... observed in marketing and other business practices are part of a general process of social change[29] Marketing has no special role in these changes and the impacts of Marketing in a postmodern world ... spiralling state of postmodern consumption and marketing (see Figure 2) Existing paradigms are totally incapable of handling this situation Marketers have to ask what kind of models are appropriate...

Ngày tải lên: 23/03/2014, 03:20

... chemical additives to make shale gas extraction more sustainable alternatives to amine absorption, including polymers and activated carbons • Understanding the behaviour, interactions and cal properties ... analysing and treating contaminated groundwater that are effective and appropriate for use by local populations, such as for testing for arsenic contaminated groundwater 1.2.3 Catalysis Catalysts ... nuclear proliferation, thus requiring a great deal of political and societal action54 ra-the expansion of nuclear power in Europe remains tain, mainly due to economic constraints and low social ac-...

Ngày tải lên: 02/06/2014, 09:39

... lead acid’ is a misnomer because no lead acid battery can be totally sealed In essence, all are valve regulated.) The SLA has a typical capacity range of 0.2Ah to 30Ah and powers portable and ... acceptance after the first recharge Advantages and Limitations of Reusable Alkaline Batteries Advantages Inexpensive and readily available — can be used as a direct replacement of non-rechargeable ... Advantages and limitations of Li-ion polymer batteries Reusable Alkaline Batteries The idea of recharging alkaline batteries is not new Although not endorsed by manufacturers, ordinary alkaline...

Ngày tải lên: 27/06/2014, 14:20

... testing To validate the results, five differentially AGATGGCTTAGATGGCTTC TDH3 GCTGCCGCTGAAGGTAAG CGAAGATGGAAGAGTGAGAGTC OPT1 TGTCCCGATTGGTGGTATTTAC MET10 CACTCACGTTCCATCCACTACC GTGTTGGTTAGTCATTGCTTCC ... (Affymetrix, Santa Clara, CA, USA) Data were analysed using the statistical methods available in the Partek ® Genomic Suite 6.5 (Partek Incorporated, St Louis, Missouri, USA) Statistical analysis ... o-phtalaldehyde/N-acetyl-L-cysteine spectrophotometric assay procedure Both ammonia and FAN were analyzed using a Roche Cobas FARA spectrophotometric autoanalyzer (Roche, Basel, Switzerland) Amino acid analysis...

Ngày tải lên: 20/06/2014, 23:20

... Yuangsaard, N., W Yongmanitchai, M Yamada and S Limtong 2013 Selection and characterization of a newly isolated thermotolerant Pichia kudriavzevii strain for ethanol production at high temperature ... Then, inoculated suspension of yeast cells into Durham tubes containing liquid of glucose 2%, and incubated at room temperature Measure the accumulation of CO2 gas in the inner Durham tubes at 4, ... tolerating high temperature attracts many researchers due to a number of potential benefits in ethanol production including reducing cost of cooling under thermal conditions, enhancing saccharification...

Ngày tải lên: 06/10/2015, 12:59

... pretreatments are acidic, alkaline, and water pretreatment Sulfuric acid and monoethanolamine (MEA) are applied as catalysts during acid and alkaline pretreatment No catalysts are applied during water ... Alkaline pretreatment and saccharification was examined by adding 3.3 g of wheat straw in 100 ml monoethanolamine solution in a 200 ml shaker flask The monoethanolamine concentration was varied ... during saccharification were conducted in a water shaker bath at 80 rpm Samples were taken every 10 h until steady state of saccharification was obtained Sugar concentration was measured using analytical...

Ngày tải lên: 05/09/2013, 15:28

... in Vietnam Most Vietnamese travel within Vietnam by long-distance bus or train Both are slow, and safety conditions not approach U.S standards Local buses and taxis are available in some areas, ... the big in asia (ie, china, japan & korea) and again as you rightly pointed out they have the most attractive demographics 70% below 30, and 2/3 below 25! always an important ingredient in a successful ... including waning signs, layout, marking HANOI - Drink driving, inadequate use of safety gear and lack of proper infrastructure combine to make for very hazardous roads in Vietnam, where motorbike accidents...

Ngày tải lên: 12/12/2013, 23:15

... have a place in patients with SAR and asthma” • Intranasal decongestants – “α1-agonist ephedrine (as nasal drops) and α 2agonist xylometazoline (available as nasal drops or spray for adults and ... of antimicrobials have received relatively little systematic investigation Available agents include saline nasal irrigation (hypertonic or normal saline), antihistamines, decongestants (topical ... seasonal and/or perennial allergic rhinitis.” • “Sedating versus nonsedating antihistamines:With respect to symptom alleviation in seasonal and perennial allergic rhinitis, study results indicate...

Ngày tải lên: 19/02/2014, 08:20

... Bed Sri Lanka, Malaysia, Thailand Auping Sultan Malaysia especially, Vietnam, Thailand Vietnam, Malaysia, Thailand, Guatamala Malaysia, Thailand, Brazil Indonesia, Malaysia, Thailand The biggest ... the world, in the main rubber producing countries such as Thailand, Indonesia and Malaysia as well as in consuming countries such as China, India, USA and the EU Regarding the main producing ... Disease Because of its toxidity, paraquat is banned in many countries, including Denmark, Sweden, Finland, 30 31 Norway and Austria In Denmark, paraquat has been banned since 1994 Paraquat was banned...

Ngày tải lên: 21/02/2014, 04:20

... Loss and Cancer Mortality in Elderly Individuals Toshihiro Ansai and Yutaka Takata 15 53 Chapter Geriatric Oral Health – Appreciating and Addressing It with a Team Approach 67 Mun Loke Wong and ... Hilary P Thean Chapter Research and Clinical Applications of Facial Analysis in Dentistry 77 Barbara de Lima Lucas, Roberto Bernardino Júnior, Luiz Carlos Gonçalves, Maria Beatriz Duarte Gavião ... studies have reported that QOL is closely related to health and financial status (Robert et al., 2009; Yamazaki et al., 2005), and maintaining satisfactory health, in particular, is essential to...

Ngày tải lên: 08/03/2014, 00:20