thursday april 14th 2011 unit 15 countries lesson c natural features

Unit 15. Countries. Lesson 2. A5- A6

Unit 15. Countries. Lesson 2. A5- A6

... ’ 7/Where is he? UNIT 15: COUNTRIES Lesson 2: We are the world – A 5 - A 6 Trang 10You are on vacation in China You write a post card to your friendTrang 11UNIT 15: COUNTRIES Lesson 2: We are ... vacation in London The weather is cold and wet. I’m traveling by bus and visiting a lot of interesting places Tomorrow, I’m going to visit The Tower of London. Love Nhan UNIT 15: COUNTRIES Lesson ... Trang 1UNIT 15: COUNTRIES Lesson 2: W e are the world – A 5 - A 6Trang 3What is this? A postcardTrang 4Eiffel Tower/ France Opera house/ Australia The Statue of...

Ngày tải lên: 01/02/2021, 13:22

24 21 0
Unit 15. Countries. Lesson 4. B3- B4

Unit 15. Countries. Lesson 4. B3- B4

... ?Trang 11Lucky Number Lucky Number Trang 12Good luck to youTrang 13Period 94: Unit 15: COUNTRIES.B Cities, buildings and people Trang 14Period 94: UNIT 15: COUNTRIES Section: B 3,4 Cities, buildings ... Trang 20Period 94: UNIT 15: COUNTRIES Section: B 3,4 Cities, buildings and peopleTrang 21The Great Wall of China.Trang 22• I Vocabulary:Period 94: UNIT 15: COUNTRIES Section: B 3,4 Cities, buildings ... thick is the Great Wall? It’s over 9 meters thick.Trang 31III/Practice: Period 94: UNIT 15: COUNTRIES Section: B 3,4 Cities, buildings and people Trang 33Work in groupsPeriod 94: UNIT 15: COUNTRIES...

Ngày tải lên: 01/02/2021, 16:53

35 16 0
Unit 15. Countries. Lesson 3. B1- B2

Unit 15. Countries. Lesson 3. B1- B2

... 20- HCM City is bigger than the capital (Ha Noi).- Mexico City is the biggest city in the world. Trang 21 Practice UNIT 15: COUNTRIES B: Cities, buildings and people Lesson 3: B1-B3 Trang 22 UNIT ... building 1 Listen and repeat Trang 17Mexico City Ho Chi Minh CityTrang 18Mexico City Tokyo2 Listen and read. UNIT 15: COUNTRIES B: Cities, buildings and people Lesson 3: B1-B3 Trang 19a bigger building/ ... go to school? I go to school by bike.? Trang 13UNIT 15: COUNTRIESB: Cities, buildings and people Lesson 3: B1-B2 Monday, April, 18 2011 Trang 141 New words:- building (n): tòa nhà, cao ốc. Ex:...

Ngày tải lên: 01/02/2021, 16:56

27 18 0
Unit 15. Countries. Lesson 1. A1­A2- A3

Unit 15. Countries. Lesson 1. A1­A2- A3

... FRENCHFRENCH ENGLISH CHINESE JAPANESE VIETNAMESE Quang Tan Secondary School Trang 20 he He Vietnamese Quang Tan Secondary School Trang 21She Japanese Trang 22She French Quang Tan Secondary School ... sentences: MarieWhere …….……… ? France Quang Tan Secondary School Trang 12John Model sentences:Trang 15Model sentences:Laura Marie Lee John Minh Yoko Where …….… ? Trang 16 * Noughts and CrossesTrang ... School Trang 23He ChineseTrang 24- Write where people are and which language they speak (using the pictures in A 1, on page 154) - Prepare Unit 15 A 5,6,7 Quang Tan Secondary School Trang 25Thanks...

Ngày tải lên: 01/02/2021, 16:58

25 28 0
Unit 15. Countries. Lesson 6. C3

Unit 15. Countries. Lesson 6. C3

... Trang 2 MOUNT EVERESTWhere am I flying ? Let’s guess! Hi!Hi! Trang 3Thursday, April 23rd , 2009 Unit 15: COUNTRIES Lesson 5: C3 *New words: flow (v) Mediterranean sea Red river gulf (n) Trang ... questions:a Which is the longest river in Viet Nam? b Where does the Mekong river start? c Which is the longest river in the world? d Which sea does the Nile river flow to? e Which is the highest ... 10 The Great Wall The Nile river SAHARA desert PHANGXIPANG MEXICO city Trang 11*Review Unit 9,10,11,12,13,14,15 for the second term test ...

Ngày tải lên: 02/02/2021, 02:16

11 17 1
Unit 15: Countries

Unit 15: Countries

... nationality (n): quốc tịch Trang 8Name 3 Listen and repeat. Country Nationality Language Bruce Viet Nam Vietnamese Yoko Lee Minh Susan Laura Chinese China Vietnamese Australia Chinese Australian ... is from ……… 6 Susan is ……… What’s Which from Japan British Viet Nam Trang 10* Match the names with the right picturesJohn USA Yoko Susan Bruce China Canada Australia Great Britain Japan ... Trang 1Unit 15: A We are the world. Friday, April 11 th 2008 Trang 21 Listen and repeat.* Who is this? * Who is this? Where is she from? Where is she from? It’s Laura It’s Marie She’s from Canada...

Ngày tải lên: 23/06/2013, 01:26

11 528 2
unit 15 : Countries

unit 15 : Countries

... X8 O9 X9 Unit 15 : Counties : lesson : C1-2 Trang 11Company LogoUnit 15 : Counties : lesson : C1-2 Homework: - Write and learn by heart vocabulary, structures. - Prepare Unit 15 : C3-4:(flow, ... 2Matching mountains 1 beaches 2 rivers 3 lakes 4 a b c d Trang 3Unit 15Trang 4www.themegallery.com Company NameLOGO  Forest (n)  Rain (n) = rừng = mưa New words Trang 5Unit 15 : Counties : lesson ... 7www.themegallery.com Company LogoUnit 15 : Counties : lesson : C1-2 ex: Does Viet Nam have any mountains ? Yes , it does No , it doesn’t  a/ forests  b/ rain  c/ deserts  d/ beaches  e/...

Ngày tải lên: 03/07/2013, 21:50

13 444 0
Unit 15: Computers - Lesson 1: Getting started + Líten and read

Unit 15: Computers - Lesson 1: Getting started + Líten and read

... Matching (to) connect Printer a Giấy bảo hành b Cái phích cắm Guarantee c S¸ch chØ dÉn Manual d M¸y in Socket e Nèi, m¾c nèi Plug f ổ cắm điện Guess/Check T T F F T F * True or False prediction ... Listen and read (P 138) I Vocabulary: - (a) printer : máy in - (a) plug : phích cắm - (a) socket - (a) manual : ổ cắm điện : cÈm nang, s¸ch chØ dÉn - (to) connect : nèi, mắc nối - (the) guarantee: ... printer is still …………………… so the company will replace it The computer can’t be connected with the printer socket because the plug has come out of the … manual You can use the to know how to repair...

Ngày tải lên: 17/07/2014, 16:00

12 770 1
Unit 15: Computers - Lesson 2: Speak + Listen

Unit 15: Computers - Lesson 2: Speak + Listen

... you are careful S3: I think driving a car is challenging Trang 9difficult boring delicious interestingentertaining unhealthy challenging easy amusing time-consuming fun dangerous * Practice: 1 ... I disagree I can’t agree with you No, I think Express and respond to opinions: Trang 6Match the words with the correct pictures:Reading comic books Playing in the rain Driving a car Foreign food ... Adjust the knob : - Challenging (adj) : - time-consuming (adj): - Entertaining (adj) : Mµn h×nh Con chuét (m¸y tÝnh) §iÒu chØnh nót vÆn §Çy th¸ch thøc Tèn thêi gian Vui ch¬i, gi¶i trÝ Trang...

Ngày tải lên: 17/07/2014, 16:00

17 656 4
Bài giảng tiếng anh 6- Unit 15. Countries

Bài giảng tiếng anh 6- Unit 15. Countries

... FRENCHFRENCH ENGLISH CHINESE JAPANESE VIETNAMESE Trang 20She Japanese Trang 21She French Trang 23- Write where people are and which language they speak (using the pictures in A 1, on page 154). ... sentences: MarieWhere …….……… ? France Trang 11John Model sentences:Where …….……… ? The USA Trang 14Model sentences:Laura Marie Lee John Minh Yoko Where …….… ? Trang 15 * Noughts and CrossesTrang ... Trang 45 Nationality (n): Quốc tịchTrang 5What and WhereTrang 6II Model sentencesWhere are you from? - I am from Viet Nam Subject be from (Country) I Vocabulary + + + * Use: Hỏi và trả...

Ngày tải lên: 30/05/2015, 11:33

24 447 0
Bài giảng điện tử tham khảo thao giảng Anh 6 Unit 15 Countries (14)

Bài giảng điện tử tham khảo thao giảng Anh 6 Unit 15 Countries (14)

... 1NGUYEN THI DINH SECONDARY SCHOOLTeacher: Vo Dat Trang 2 NGUYEN THI DINH SECONDARY SCHOOL NGUYEN THI DINH SECONDARY SCHOOL Teacher: Vo Dat Trang 31, The boys usually play this sport Which sport is it? ... 14What and WhereTrang 15II Model sentences:Where are you from? - I am from Viet Nam Subject (be) from (Country) I Vocabulary: + + + Trang 16(?) Which country is it ?Canada China The USA Great ... Britain Canada English English & Canadian Trang 22Susan Great Britain British English Trang 24Marie France French French Trang 25Lee China Chinese Chinese Trang 26John The USA American...

Ngày tải lên: 10/06/2015, 10:12

29 341 1
Bài giảng điện tử tham khảo thao giảng Anh 6 Unit 15 Countries (15)

Bài giảng điện tử tham khảo thao giảng Anh 6 Unit 15 Countries (15)

... Great Wall of ChinaTrang 2Thursday, April 11th 2013Trang 4Unit 15( Cont)1 Listen and read: Period 95: C- Natural features( 1,2). - rain ( n, v): mưa - forest ( n) : rừng sa mạc - desert ( n) ... beaches It is a great country. We have lots of rain, so the country is very green We have big forests and we don’t have any deserts. Trang 7Unit 15( Cont)1 Listen and read: Period 95: C- Natural ... forests beaches deserts rivers Trang 9Unit 15( Cont) - rain ( n, v): mưa - forest ( n) : rừng sa mạc - desert ( n) : nhiều - a lot of = lots of: * Newwords: * Grammar: To have( Có) Ex: We...

Ngày tải lên: 10/06/2015, 10:12

12 261 0
Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

... 5¢-GGTGTAGAATTCAAGAACGAGGAACTGCG-3¢ was combined with (a) 5¢-ATAGTTTAGCGGCCG CTTACTTCCGGCGGATGATGAGCGAG-3¢ for e1–219, (b) 5¢-ATAGTTTAGCGGCCGCTTAGTGATGGTGATG GTGATGCTTCCGGCGGATGATGAGCGAG-3¢ for ... 219HIS, (c) 5¢-ATAGTTTAGCGGCCGCTTACGGCTT CCGGCGGATGATGAGCGAG-3¢ for e1–220, or (d) 5¢ATAGTTTAGCGGCCGCTTAGTGATGGTGATGGTGA TGCGGCTTCCGGCG-GATGATGAGCGAG-3¢ for e1– 220HIS (underlined EcoRI and NotI) ... ATTCCGGAACCAGGAGGAGCGC-3¢ was used in all cases, together with the reverse primer (a) 5¢-ATA GTTTAGCGGCCGCTTACTTGCGCTGGATGATGAG CAGG-3¢ for c1 –218, (b) 5¢-ATAGTTTAGCGGCCGC TTAGTGATGGTGATGGTGATGCTTGCGCTGGATG...

Ngày tải lên: 30/03/2014, 10:20

12 401 0
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_2 doc

Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_2 doc

... different time zones can also be difficult Conducting conference calls with an international audience, however, requires the coordination of a space shuttle launch Conference calls scheduled for early ... most successful organizations, a pioneer of new organizational concepts such as Variance Optimization and Employee Confidence He is experienced with manufacturing, financial services, heath care, ... travel costs associated with securing the productive working relationships needed for acquisition success Understanding that reactions to the change will differ widely by local country culture Securing...

Ngày tải lên: 21/06/2014, 08:20

28 358 0
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_4 pdf

Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_4 pdf

... set cooperative goals and, when conflict 54 Going Global occurs, employ cooperative conflict management strategies (Chen et al., 2006) Critical Process #2: Ensuring Clear and Meaningful Communication ... Teams: Critical Team Processes and Guidelines 51 that researchers have not been conceptually disciplined when it comes to the constructs which are identified as process, often confounding process ... of these critical components Critical Components Driving Effectiveness in Multicultural Teams • Process Components Engaging in leadership—creating and maintaining coherence Ensuring clear and...

Ngày tải lên: 21/06/2014, 08:20

28 400 0
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_6 doc

Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_6 doc

... strategic and objective, networks based on social contacts, caste, and other social connections still influence human resource policies and practices Indians, for example, are relatively more collectivist, ... contexts serve as contingencies that influence human resources practices in general and recruitment in particular Key exogenous or external contingency factors include the legal, societal or cultural, ... question may be culture-speci c (for example, criteria and sources of recruitment) (Tayeb, 1995; 1998) This is especially the case because historical legacies, social stratification, educational system,...

Ngày tải lên: 21/06/2014, 08:20

28 372 0
Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_7 potx

Going Global Practical Applications and Recommendations for HR and OD Professionals in the Global Workplace J-B SIOP Professional Practice Series by Kyle Lundby, Jeffrey Jolton and Allen I. Kraut_7 potx

... for educational and psychological testing, created by the American Educational Research Association, American Psychological Association, and the National Council on Measurement in Education (Oakland, ... must deal with effectively A more acceptable (to companies) approach in Asia, at least, is the concept of the competency model The use of competency models is becoming more accepted in the region ... predetermined recruitment process that can be used across locations Technological Sophistication The final contingency we discuss in this chapter is the level of organizations’ ever-expanding technological...

Ngày tải lên: 21/06/2014, 08:20

28 435 0
w