think through the alternatives to taking a risk

Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx

Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx

... equal to or greater than 25 [23] Although there are certain limitations to BMI i.e large muscular athletes who are in good cardiovascular shape, the rationale behind these numbers is that, across ... relieved their low back pain symptoms after obesity surgery, that patients with a BMI of greater than 40 are at a high risk of developing low back pain Albeit controversial, Table may lead to a further ... positively associated with low back pain, in particular with chronic or recurrent low back pain [27] What appears to be a main concern in linking obesity as a causal factor for low back pain is the...

Ngày tải lên: 13/08/2014, 13:22

6 403 0
The Secret to Winning a Start-up Competition

The Secret to Winning a Start-up Competition

... with the electronic catalog pages Roughly $270 billion in retail sales is generated by catalogs, according to the American Catalog Mailers Association CoffeeTable has more than 170 retail partners, ... had tough competition In his category, he went up against ShopAdvisor, a save-it-forlater service that alerts consumers when an item they want to buy is available, or when it drops to a certain ... 150-year-old $10 billion company that prints catalogs (RR Donnelly is banking that CoffeeTable will take it into the future.) The CoffeeTable app is free to download The company makes money by charging...

Ngày tải lên: 20/01/2014, 13:47

3 381 0
The road to reality   a complete guide to the laws of the universe    penrose, roger

The road to reality a complete guide to the laws of the universe penrose, roger

... would regard mathematical objectivity as really what mathematical Platonism is all about To say that some mathematical assertion has a Platonic existence is merely to say that it is true in an objective ... entities may relate to physical reality I recall that when at school, at the age of about 11, I was somewhat taken aback when the teacher asked the class what a fraction (such as 3) actually is! Various ... be the Sun It was a distant shaft of a deep Wery red light that beamed vertically upwards from the water into the heavens As he stood there, a dark cloud became apparent at the head of the beam,...

Ngày tải lên: 17/03/2014, 14:53

1,1K 544 4
''''The Worst Place in the World to be a Woman or Girl'''' – Rape in the DR Congo: Canada, Where Are You? docx

''''The Worst Place in the World to be a Woman or Girl'''' – Rape in the DR Congo: Canada, Where Are You? docx

... information on the locations of armed groups and needs technical and financial support to compile data on mineral-rich areas and to make the map accessible to the global public Canada, as the largest ... decreasing its support and political engagement in the DRC and throughout the Great Lakes Region In 2007, Canada terminated the mandate of the Canadian ambassador to the Great Lakes Region, who had ... Wijeyaratne, 17 Afghanistan, Bangladesh, Bolivia, Caribbean, Colombia, Ethiopia, Ghana, Haiti, Honduras, Indonesia, Mali, Mozambique, Pakistan, Peru, Senegal, Sudan, Tanzania, Ukraine, Vietnam,...

Ngày tải lên: 22/03/2014, 21:20

27 419 0
The Making of a Consultant The Keys to Establishing a Successful Consulting Career potx

The Making of a Consultant The Keys to Establishing a Successful Consulting Career potx

... consultants have at least a Masters in Business Administration (MBA) Apart from attaining a tertiary qualification, the process of learning, especially at a higher level provides a variety of other ... because they not know where or how to find work As a result, they often have cashflow problems and are forced to quit consulting altogether and opt for a regular job with a guaranteed salary There are ... you are keen to develop your profile as a high-flying consultant, audit your skills and see where the gaps are Get that additional qualification that can set you apart and propel you to further...

Ngày tải lên: 27/06/2014, 23:20

12 441 0
Branding Yourself OnlineHow to Use the Internet to Become a Celebrity or Expert in Your Fieldby pptx

Branding Yourself OnlineHow to Use the Internet to Become a Celebrity or Expert in Your Fieldby pptx

... a problem that you solve People take action because they either want to move closer to pleasure or away from pain Of the two reasons, pain is the greater motivator For example, when you had a ... program All Things Considered has listeners; Howard Stern has fans Entertainment Tonight has viewers; David Letterman has fans The Dallas Cowboy Cheerleaders have admirers; Pamela Anderson has ... focus After all, that’s what a brand name does: It stands for something specific to a particular group of people you hope to transform into fans Let’s look at an example on a smaller scale Rebecca...

Ngày tải lên: 28/06/2014, 12:20

20 359 0
Branding Yourself OnlineHow to Use the Internet to Become a Celebrity or Expert docx

Branding Yourself OnlineHow to Use the Internet to Become a Celebrity or Expert docx

... a problem that you solve People take action because they either want to move closer to pleasure or away from pain Of the two reasons, pain is the greater motivator For example, when you had a ... program All Things Considered has listeners; Howard Stern has fans Entertainment Tonight has viewers; David Letterman has fans The Dallas Cowboy Cheerleaders have admirers; Pamela Anderson has ... focus After all, that’s what a brand name does: It stands for something specific to a particular group of people you hope to transform into fans Let’s look at an example on a smaller scale Rebecca...

Ngày tải lên: 28/06/2014, 18:20

20 434 0
Báo cáo lâm nghiệp: "Frost damage on the terminal shoot as a risk factor of fork incidence on common beech (Fagus sylvatica L.)" docx

Báo cáo lâm nghiệp: "Frost damage on the terminal shoot as a risk factor of fork incidence on common beech (Fagus sylvatica L.)" docx

... explanatory factor which was much significant than the other variables and factors available Thus overall, the damage factor had both a statistical and a causal value, i.e functional and more precisely ... increasing the level of the risk factor [10] Finally, the logistic model, applied to the probability of fork presence in plots P1 and P2 together, confirmed that “damage” was an explanatory factor ... experimental method has the advantage of allowing one to bypass the frost itself in a way, as its characteristics are always difficult to define accurately at the tree scale This type of experiment also...

Ngày tải lên: 07/08/2014, 16:20

8 349 0
Báo cáo y học: "Through the rear view mirror: a content evaluation of the journal of Chiropractic & Osteopathy for the years 2005–2008" pps

Báo cáo y học: "Through the rear view mirror: a content evaluation of the journal of Chiropractic & Osteopathy for the years 2005–2008" pps

... really meeting that objective An International journal Originally the journal was to be an Australasian journal This was later changed to an international journal with an international editorial ... States in a journal that originates in Australasia is problematic The lack of any paper from New Zealand, Oceania including islands of the Pacific Ocean, and Asia would also seem to imply that the ... challenges if it wants to be an international journal for chiropractic The lack of any papers we could find as having an Australasia source is also a challenge for the journal The objective to publish...

Ngày tải lên: 13/08/2014, 14:20

4 152 0
hack proofing coldfusion - the only way to stop a hacker is to think like one

hack proofing coldfusion - the only way to stop a hacker is to think like one

... existence.What the phreaker had to was DTMF dial into the line via a blue box Being able to access the special line was the basic equivalent to having root access into Ma Bell .The irony of this elaborate ... various ways Security professionals hack into networks and applications because they are asked to; they are asked to find any weakness that they can and then disclose them to their employers.They ... local to the page template Scoping variables also increases performance Using Use to set the scope and value type of the variable you expect on a page:

Ngày tải lên: 25/03/2014, 11:18

545 735 0
hack proofing xml - the only way to stop a hacker is to think like one

hack proofing xml - the only way to stop a hacker is to think like one

... drives the attacker We then consider the types of attacks that can be made against computer systems in general Again, we start from the general and work toward the specific It is a safe bet that whatever ... be classified as a hacker emerges whose primary goal appears to be to power or financial gain.There have been a few famous examples that have made the press, having to with illegal wire transfers ... as what the attacker can gain by using them Identifying and Understanding the Classes of Attack As we mentioned, attacks can be placed into one of a few categories Attacks can lead to anything...

Ngày tải lên: 25/03/2014, 11:18

402 414 0
A.A.? No Way! Alternatives to the status quo programs that fail Charles Delaney pot

A.A.? No Way! Alternatives to the status quo programs that fail Charles Delaney pot

... millennia to ease the moral burden and clear the way to start anew So why then half-step and make the admission to a stranger, such as a priest, you'll not have to deal with again? It let's one off the ... to alcoholics, and to practice these principles in our daily affairs Another variance and near redundancy since belief, morality, and action are interwoven on the pagan path There's no reason to ... There are some drugs that have been found that are able to suppress the the runaway activity of the instinctual part of the brain, allowing the cognitive brain a chance to get it's say in what's...

Ngày tải lên: 27/06/2014, 23:20

20 257 0
Báo cáo y học: " High avidity autoreactive T cells with a low signalling capacity through the T-cell receptor: central to rheumatoid arthritis pathogenesis" pot

Báo cáo y học: " High avidity autoreactive T cells with a low signalling capacity through the T-cell receptor: central to rheumatoid arthritis pathogenesis" pot

... H, Iwakabe K, Yahata T, Nishimura S, Ohta A, Ohmi Y, Sato M, Takeda K, Okumura K, Van Kaer L, Kawano T, Taniguchi M, Nishimura T: The natural killer T (NKT) cell ligand alphagalactosylceramide ... 100:2404-2414 Sakaguchi N, Takahashi T, Hata H, Nomura T, Tagami T, Yamazaki S, Sakihama T, Matsutani T, Negishi I, Nakatsuru S, Sakaguchi S: Altered thymic T-cell selection due to a mutation of the ZAP70 ... factor/nuclear factor-κB drive in rheumatoid arthritis Based on human and animal data, what are the key factors that drive chronic inflammation in RA? Experiments in different animal arthritic...

Ngày tải lên: 09/08/2014, 10:23

9 410 0
báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" pptx

báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" pptx

... assistants, and post-graduate medical trainees) from the primary care administration staff at Facilities A and B The data on provider types were used to compare HIV testing and evaluation performance across ... [19] To confirm and extend these data, we evaluated the rates of HIV testing in veterans seen in the five southern California and Nevada VA facilities (otherwise referred to as Veterans Integrated ... testing a performance monitor, to support installation of the HIV Testing Clinical Reminder, and to participate as full partners in enhancing station accountability After obtaining national and regional...

Ngày tải lên: 11/08/2014, 05:22

13 342 0
báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx

báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx

... ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat 781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaa 61 ... Q L Q L E L E aagcatcttcatgatcaattagagatgcaaatgaatttacaaaagctgattgaggatcaa K H L H D Q L E M Q M N L Q K L I E D Q gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataatttgag G K Q V K M M L ... cgccttggaggttctgagaaggcaacaccaaaggcgatactgaaactgatgaaatcgaaa R L G G S E K A T P K A I L K L M K S K gaattgagtatcctacaagtaaaaagtcatttgcagaaatatcgatccgagaagctcata E L S I L Q V K S H L Q K Y R S E K L I tcagaccagtctttacaaggatttcccgagaaaacagtttgtatcaatgatatacctcag...

Ngày tải lên: 11/08/2014, 11:21

14 400 0
báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" docx

báo cáo khoa học: " Implementing and evaluating a regional strategy to improve testing rates in VA patients at risk for HIV, utilizing the QUERI process as a guiding framework: QUERI Series" docx

... assistants, and post-graduate medical trainees) from the primary care administration staff at Facilities A and B The data on provider types were used to compare HIV testing and evaluation performance across ... [19] To confirm and extend these data, we evaluated the rates of HIV testing in veterans seen in the five southern California and Nevada VA facilities (otherwise referred to as Veterans Integrated ... testing a performance monitor, to support installation of the HIV Testing Clinical Reminder, and to participate as full partners in enhancing station accountability After obtaining national and regional...

Ngày tải lên: 11/08/2014, 16:21

13 590 0
Báo cáo y học: " ALGOS: the development of a randomized controlled trial testing a case management algorithm designed to reduce suicide risk among suicide attempters" potx

Báo cáo y học: " ALGOS: the development of a randomized controlled trial testing a case management algorithm designed to reduce suicide risk among suicide attempters" potx

... salary from an organization that may in any way gain or lose financially from the publication of this manuscript - They doesn’t hold any stocks or shares in an organization that may in any way ... In all cases, a report of the telephone calls (or if the participant is lost of contact, the information that we have failed to call him) is sent to the general practitioner and eventually to the ... follow-up ALGOS algorithm would be more a «crisis management plan», rather than a «case management plan» The main objective is to evaluate the effectiveness of the algorithm in reducing the number...

Ngày tải lên: 11/08/2014, 16:22

7 287 0
w