think of a number
... Indian system spread to Italy. ENGLAND 1100 AD Adelard of Bath, an English monk, visited North Africa disguised as an Arab He translated Al Khwarizmi’s books and brought zero back to England As ... scored again and again after the midway point The official attendance was “as many as the ground holds”. Spain: a lot of goals Italy: not quite so many Colombia: no goals Nigeria: some goals Germany: ... discovered farming and invented ways of writing numbers The Mayans had a number system even better than that of the Egyptians They kept perfect track of the date and calculated that a year is
Ngày tải lên: 27/10/2014, 17:35
... mathematics of those times In particular, the use of algebra is illustrated by many examples of varying degrees of difficulty and importance Strangely, one and one alone has achieved a fame far ... tusks and claws, as well as all the Fibonacci-related cones and flowers Trang 23Think of a Number discussed earlier, are nearly always found to be portions of equiangular spirals Fibonacci's whirling ... get this is just another verification of the fact that the golden ratio is an irrational number Another mathematical quirk of the Fibonacci numbers is of particular interest since it was (to the
Ngày tải lên: 30/04/2021, 17:47
... Applicable entities 1 Article 3 Applicability of the Law on Enterprises, international treaties and relevant laws 2 Article 4 Party and mass organizations within an enterprise 2 Article 5 Capital ... of issued shares is the number of shares fully paid up to the company by shareholders The charter capital of a shareholding company on the date of registration of business [and] establishment of ... animals, on the lists in international treaties of which Vietnam is a member, and all types of rare wild animals and plants on the lists prohibiting the use and exploitation of such animals and
Ngày tải lên: 27/03/2014, 10:15
Chapter 27: An Introduction to PL/SQLThe Exception Handling section of a PL/SQL block is pot
... load Disabling the triggers during data loads may dramatically improve the performance of the load After the data has been loaded, you need to manually perform the data manipulation... creating ... creating package specifications: create [or replace] package [user.] package [authid {definer | current_user} ] {is | as} package specification; A package specification consists of the list of ... modifications (shown in bold). A new variable named some_variable is declared in the Declarations section, and a calculation to determine the variable’s value is created in the Executable Commands
Ngày tải lên: 07/08/2014, 14:20
Báo cáo toán học: "The degree of a q-holonomic sequence is a quadratic quasi-polynomial" docx
... Trang 1The degree of a q-holonomic sequenceis a quadratic quasi-polynomial Stavros Garoufalidis ∗ School of Mathematics Georgia Institute of Technology Atlanta, GA 30332-0160, USA stavros@math.gatech.edu ... differential operator case Indeed, q is a variable whichseems to be independent of the spacial variables x of a differential operator The meaning of the variable q can be explained by Quantization, or ... operator is regular-singular with eigenvalues of equal constant term In thatcase, we can construct a basis of formal WKB solutions of the required type The above proofalso factorizes a linear
Ngày tải lên: 08/08/2014, 14:23
Báo cáo y học: "Thrombomodulin phenotype of a distinct monocyte subtype is an independent prognostic marker for disseminated intravascular coagulation" ppsx
... using the chi-square test Kaplan-Meier survival analysis by the log-rank method was carried out for survival analysis of 28-day survival Univariate and multivariate Cox regression analyses were performed ... MedCalc (Med-Calc Software, Mariakerke, Belgium) A P value of less than 0.05 was set for statistical significance Results Monocyte population according to overt disseminated intravascular coagulation ... Imubind Tissue Factor ELISA kit (American Diagnostica Inc., Stamford, CT, USA) Flow cytometric analysis From ethylenediaminetetraacetic acid-treated whole blood that remained after measurement of complete
Ngày tải lên: 14/08/2014, 08:21
Acceptability, safety and contraceptive efficacy of a new single rod subdermal 3 ketodesogestrel implant in singaporean women acceptors
... 23These ambitious targets can only be reached by making available a wider choice of safe, acceptable and affordable contraceptives and high-quality family planning services on a voluntary basis ... trials in many parts of the world This thesis is an evaluation of safety, contraceptive efficacy and acceptability of IMPLANON™ implants in Singaporean women An open, randomized, group comparative, ... family planning research CHAPTER II HISTORY OF THE DEVELOPMENT OF 34 CHAPTER IV IMPLANON TM : PHARMACOLOGY, PHARMACODYNAMICS AND DRUG SAFETY (a) Chemistry and Pharmacy (b) Pharmacology of
Ngày tải lên: 15/09/2015, 21:09
DECREE NO 1492016ND CP DATED NOVEMBER 11, 2016, AMENDING AND SUPPLEMENTING a NUMBER OF ARTICLES OF DECREE NO 1772013ND CP ON THE IMPLEMENTATION OF a NUMBER o149 2016 ND CP 332872
... follows: “1 Submission and appraisal of price plan c) For goods and services under the valuation competence of ministries, Ministers shall prescribe the submission and appraisal of price plan, decide ... Committee of province for decision, it must obtain an appraisal opinion in writing from the Service of Finance The appraisal of land price and price plan shall comply with legislation on land.” 9 Clause ... as follows 1 Article 1 is amended as follows: “Article 1 Scope of regulation This Decree stipulates in detail and guides the implementation of a number of articles of the Law on Pricing and Article
Ngày tải lên: 24/02/2017, 21:14
Decree No. 60 2015 ND-CP guiding the implementation of a number of articles of the securities Law and the law amending
... implementation of a number of articles of the securities Law and the law amending and supplementing a number of articles of securities Law Article 1 To amend and supplement a number of articles of the ... stipulating in detail and guiding the implementation of a number of articles of the securities Law and the law amending and supplementing a number of articles of securities Law Pursuant to the Law ... d) The issuing company is not the parent company of the stock offering company; or neither of companies are subsidiary companies of a parent planned to swap, swap-rate calculation method and specific
Ngày tải lên: 23/10/2017, 20:26
Nhật Bản. Trung quốc Legal systems of a number of East Asian COUNTRIES
... Japanese legal system Trang 13• 6B4 Be able to compare legal education in Japan and that in France, Germany, UK, US • 6B5 Be able to compare court system in China and that in Japan • 6B6 Be able ... Law Family - Macao – Civil Law Family Trang 5SOURCES OF LAWTrang 8(1852 – 1912)Trang 9Douglas MacArthur (1880 - 1964)Trang 10• 6A1 Be able to roughly present Japanese legal system • 6A2 Be able ... • 6A9 Be able to present roughly legal education and legal professions in China Trang 12• 6B1 Be able to present the typical features of formation and development history of • Japanese legal
Ngày tải lên: 09/09/2019, 11:05
Optimizing the placement of a number of D-Statcom for improving SARFIX in the distribution system
... D-Statcom in the test system, we have m=2 and the total scenarios for plac-ing these two D-Statcoms is T2= C2 33=2!×(33−2)!33! = 528 Each candidate scenario to be tested is a pair of buses number ... calculate bus voltage matrix with the pres-ence of D-Statcoms and finally SARFIXis calculated Preset parameters can be seen as input data “postop” is the intermediate variable that updates the ... Block diagram of the problem of optimization. and Discussion RESULT ANALYSIS AND DISCUSSION IEEE 33-Bus Distribution System In the paper, the IEEE 33-bus distribution feeder (Fig-ure7) is used as
Ngày tải lên: 12/01/2020, 02:35
Summary of Phd thesis Business administration: A study of the impacts of ceo’s characteristics on the performance of a number of outstanding listed enterprises
... Trang 1SUMMARY OF PHD THESIS A STUDY OF THE IMPACTS OF CEO’S CHARACTERISTICS ON THE PERFORMANCE OF A NUMBER OF OUTSTANDING LISTED ENTERPRISES Major: Business Administration Code number: 9340101 ... individual characteristics of each person are governed by four basic attributes: stability, unity, activeness and interpersonal characteristics. At the same time, the CEO's personal characteristics also carry all the basic attributes of the personal trait This system of characteristics ... Following the approach from the basic management model, the CEO (Chief Executive Officer) is the highest executive position of an organization, in charge of overall operation of a corporation, an enterprise, the organization or an agency, making the strategic decisions of the organization, and being responsible to the board of the
Ngày tải lên: 28/09/2020, 01:07
Anticancer activity of a thymidine quinoxaline conjugate is modulated by cytosolic thymidine pathways
... may well be expanded in the applications of other thymidine analogs used for cancer diagnosis and therapeutics Availability of supporting data The data supporting the results of this article are ... read and approved the final manuscript. Acknowledgements This work is supported by the National Natural Science Foundation of China (81372403) and the National Basic Research Program of China (2011CB933100) ... intratumoral injection of TYMP shRNA followed by intravenous injection of dT-QX or PBS; Statistical analysis of the treatments was performed with GraphPad Prism software using two way ANOVA with
Ngày tải lên: 30/09/2020, 11:07
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC 30 to 319 CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC 71 to 319 CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC 102 to 319 CACCATGCTGAAAGCTGCGCTGGAGAAC ... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG pGAD-DNter2 CARP from 71 to 319 GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG pYFP-CARP-CFP-HIS Full-length CARP 1–319 CACCATGATGGTACTGAGAG ... 319 CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC 124 to 319 CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC 1 to 70 CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC
Ngày tải lên: 29/03/2014, 21:20
Báo cáo toán học: "The toric ideal of a matroid of rank 3 is generated by quadrics" pps
... combinatorial approach A matroid has several equivalent definitions We define a matroid by a set of subsets that satisfies the exchange axiom A family B of sets is the collection of bases of a matroid ... Trang 1The toric ideal of a matroid of rank 3is generated by quadrics Kenji Kashiwabara Department of General Systems Studies, University of Tokyo, 3-8-1 Komaba, Meguroku, Tokyo, 153-8902, Japan ... pro-posed a base-sortable matroid and showed that the toric ideal of a base-sortable matroid has a square-free quadratic Gr¨obner basis This fact implies that Conjecture 1 is true for the matroids of
Ngày tải lên: 08/08/2014, 12:22
A number of measures to improve the efficiency of remembering and using englinsh vocabulary for students in grade 3,4,at ha phong primary school
... situation We can think that vocabulary are bricks, grammar isanother factor of language are considered as the grout to set up a homelanguage Teaching vocabulary is an important issue, but learning how ... teaching of any language, the role of vocabulary is very important So we can also say that “language is a set of vocabulary” That does not mean theonly unit to understand the individual words, ... useful and necessary Because when the students have a large amount ofvocabulary they can not only understand immediately what their teacher issaying and answer the teacher, s requests but also make
Ngày tải lên: 16/10/2019, 08:37
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx
... maximal arithmetic subgroups, preprint; available on arXiV as math.GR/0501198. [2] M. Bhargava, The density of discriminants of quartic rings and fields, Ann. of Math. 162 (2005), 1 031 –10 63. [3] ——— , ... result. Remark 3. 2 (Shape of number field lattices). Lemma 3. 1 emphasizes the importance of understanding the shape of number field lattices. For clarity, fix attention on totally real number fields of degree ... Komaravolu Chandrasekharan with the assistance of Rudolf Suter, with a preface by Chandrasekharan), Springer-Verlag, New York, 1989. [21] D. J. Wright, Distribution of discriminants of abelian extensions,...
Ngày tải lên: 06/03/2014, 08:21
current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc
... What is software outsourcing, its advantages and disadvantages? ii) What is current situation of software outsourcing in Vietnam and which potentials it possesses? iii) What is FPT Software and ... countries as China, Russia, Malaysia and Philippines may take this place. China is a perfect example of good software outsourcing destination with full factors of attraction. Chinese companies and ... approximately the same as India’s a decade ago and the wage rates in Vietnam are roughly the same as India’s initial rates. As such, a lot of people have raised the question that whether Vietnam...
Ngày tải lên: 27/10/2012, 16:41
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
... in particular and with our American friends in general. II.2.2. Racial discrimination Racial discrimination is as old as American history since the first black African slaves came to America over ... respectful attitudes of Paley and Alvarez towards the value of life are always appreciated, especially in the contemporary age of technology, diseases and social evils, which has caused escalating ... cohabitation before marriage is a common practice, or even a fashion among young American and among the American people on the whole. Statistics shows that 41% of American women ages 15-44 have...
Ngày tải lên: 07/11/2012, 15:01
A Student Grammar of Spanish - Number
... alicate pliers *la braga panties, knickers *la escalera stairs la estad´ıstica statistics *la gente people *la malla tights *el pantal´on pants, trousers el pijama / la piyama (M) pajamas *la pinza ... S´olo sab´ a una palabra clave, nada m´as, porque su lengua madre era el ´arabe. El due ˜no le ofreci´o una luz piloto de gran calidad. Sali´o del almac´en y, con su amigo israel´ıysuamiga hind´u, ... amigos recibir la carta al d´ a siguiente Caminar (M)/andar hasta Correos No manejar un carro (M)/conducir un coche (Yo) entrar en la cocina y abrir la ventana Regresar a casa Escribir una carta...
Ngày tải lên: 01/11/2013, 06:20