the use of spreading codes in a cdma system 111

... ” The objectives of the study are to describe the situation of using contraceptive injections in Aluoi district and investigate factors relating to the acceptance of using contraceptive injections ... calculation was used to find out the rate of withdrawal from contraceptive injections in women of reproductive age who are still married The sample size was calculated according to the ratio ... General information about the subjects were age, geographical area, religion, education, marital status, occupation, family financial situation, situation of pregnancy and delivery, and the present...

Ngày tải lên: 19/01/2020, 18:42

... pathogenesis of emphysema according to regional location within the lung, since the data clearly indicate a graded response to therapeutic aug-mentation of AAT The graded therapeutic effect that was most ... between the apical, middle and basal regions, whereas in the active treatment arm, the rate of emphysema progression in the basal region was lower than that of either the apical or middle regions A ... CT scan as Lung Endpoints (EXACTLE) trial aimed to clarify the optimum approach to the use of CT densitometry data for the assessment of alpha 1-antitrypsin (AAT) augmentation therapy on the progression...

Ngày tải lên: 12/08/2014, 14:20

... was a slightly lower increase or even a decrease in genetic gain for trait A, as well as in average kinship, when trait B accounted for more than 80% of EBV When only trait B was taken into account ... be interested in doing so For instance, in the dairy cattle breed Abondance (a local selected breed in the French Northern Alps), the semen of a bull born in 1977 (called Naif), which was rarely ... independent of A i In the following generations, genetic values of individual i were simulated from the genetic values of its sire (Ap and Bp) and its dam (Am and Bm), taking into account the parent’s...

Ngày tải lên: 14/08/2014, 13:21

... with the introduction of Socratic Seminar, the use of it in education, how it is linked to speaking teaching The review indicated that the use of Socratic Seminar in language Trang 30teaching in ... have a discussion about a topic that they are incapable of, if they want to say anything about the topic, they will use their own language Another reason is that the use of mother- tongue is a natural ... (1998) defines speaking as “the process of building and sharing meaning through the use of verbal and non-verbal symbols in a variety of context” 2.2 The importance of speaking skill Of all the four...

Ngày tải lên: 12/09/2019, 15:19

... skills in organizing and planning learning activities, working collaboratively with others, giving and receiving feedback and evaluating their own learning Peer learning is becoming an increasingly ... important part of many courses, and it is being used in a variety of contexts and disciplines in many countries The potential of peer learning is starting to be realized, but examination of the ways ... learning from and with each other in both formal and informal ways The emphasis is on the learning process, including emotional support learners offer to each other, as much as the learning task...

Ngày tải lên: 29/01/2014, 10:49

... the others in their communities; for mammal animals such as the lions and the dogs, they may bark or grind as the signals of communicating In another example of the birds, they may sing to call ... research From such expectations of the findings, the author will use the methods of translating the speeches made in the inaugural addresses of the Presidents Bush and Obama for elaborated analysis, ... in determining the interaction pattern of the communication, so that each participant can have his or her meaning of the meaning and intention of the speaker In most social affair, this used to...

Ngày tải lên: 28/02/2015, 11:54

... researchers and teachers have begun to advocate a more bilingual approach to teaching, which would incorporate the students‟ L1 as a learning tool Others have even gone as far as saying the use of L1 in ... hundred years ago bilingual teaching was the „norm‟, with students learning through translation The use of L1 to study L2 was almost universal and readily accepted, in part because language teaching ... indiscriminate and wide use of L1 in the classroom Supporters of the Bilingual Approach have been quick to clarify by stating that they do not support widespread and indiscriminate use of L1 in the...

Ngày tải lên: 02/03/2015, 14:17

... defined as the ―set of semantic configuration that is typically associated with a particular class of context of situation, and defines the substance of the text.‖ According to Halliday and Hasan, the ... developments of various approaches to grammar, known as traditional grammar, universal grammar, descriptive grammar or generative grammar However, since the appearance of systemic functional grammar (SFG), ... of substitution: nominal, verbal and clausal In other words, the substitutes may function as a noun, as a verb, or as a clause and they all can be interpreted in relation to what has been said...

Ngày tải lên: 15/07/2015, 12:57

... teaching grammar is not necessary in a classroom setting In fact,there are a large number of teachers who are aware of the value of grammar and that it should not be over-emphasized Also, there ... to useand apply the target language at degree of language autonomy and keep the balanceof focus between language forms and meanings Littlewood also gave an example of dialogues that learners had ... most of the teachers and students had positive attitudes and motivation to theuse of communicative activities in learning and teaching grammar Many of theEnglish teachers at Newstar international...

Ngày tải lên: 19/07/2015, 18:38

... to analyze the activities taking place among employees from a systematic perspective and explaining the interrelationship of dynamic social capital in an organization Accordingly deliberate investment ... clearer and more extensive explanation on the use of ES in achieving organizational advantage SC is therefore, defined as “the sum of the actual and potential resources embedded within, available ... relationship of ES users’ interests, behavior and attitudes in the social and organizational context, an interpretive case study was conducted with Talam Corporation Talam has a year experience in managing...

Ngày tải lên: 14/09/2015, 09:01

... be the sales aspect of e-business It also consists of the exchange of data to facilitate the financing and payment aspects of business transactions E-commerce has become a source for organizational ... using a system that created by belief in usefulness and ease of use - Behavioral intention of use: was the intention of people to using this system According to Davis, PU was the main point and PEU ... population because it can waste a lot of time In this case, sample was a good solution, sample was defined as a small percentage of a population In this research, the population was defined that all consumers...

Ngày tải lên: 22/10/2015, 13:28

... notion of metafunction of language The data of the research contain ten Hillary Clinton’s speeches from 2010 to 2016 Both the quantitative and qualitative methods are adopted to analyze the data The ... that language is one of the most effective instruments of persuasion Accordingly, almost all of the politicians are good at eloquence Hilary Clinton, whether in the role of the First Lady of the ... paralanguage The relations of situation and culture are central to Halliday’s conception of language as an open dynamic system, as a “vast, open-ended system of meaning potential, constantly renewing...

Ngày tải lên: 11/12/2017, 11:08

... study All of them are at the age of 16 Their time length of learning English is also the same because they all started learning English in grade 3 Most of them have the same level (pre-intermediate) ... prepared before the interview to ask teachers about their attitude, evaluation toward the use of group work in speaking lessons The advantages of interviewing include the ability to check the teacher's ... learning English If speaking activities are held in the suitable and creative way, students can find speaking more exciting and motivation in the learners can be raised The other skills can also...

Ngày tải lên: 16/08/2018, 14:28

... of ATs in general: Trang 23The markers of social relation and family relation within a particular society The markers of attitude and feeling The occupants of statuses An attempts to manipulate ... is also a product of culture and history In Vietnam, especially in the Vietnam family, all of the members in the family are usually aware of the fact that a suitable address terms can establish ... claims that culture is a systematic association of people that have a certain way of life Therefore, culture is the only distinction between human and animals Of course, animals live in association...

Ngày tải lên: 26/11/2018, 10:59

... English aware of the importance L1 in EFL classrooms Harmer (2007) called the process of translating what the students are learning in their heads is a “natural part of any language learner’s behavior,” ... going to examine in detail whether or not the use of learners’ L1 in the classroom may hinder or facilitate the process of learning new vocabulary in a second language About the positive role of ... because the learners always try to make sense a new language through a language which they already know The use of L1 in English classrooms is mainly the use of translation from L1 into L2 and...

Ngày tải lên: 20/02/2019, 21:12

... Lygo-Baker, 2008, p 309) Seen as a new way in the art of representing the relations between elements amidst various areas of knowledge, the cartographic language has generated an increasing fascination ... weaknesses in the use of concept maps as a learning strategy in undergraduate health programs Knowledge Management & E-Learning, 9(3), 380–391. Trang 2Challenges and weaknesses in the use of concept ... by the Institute for Human & Machine Cognition (IHMC) Training was provided through an adaptation of the proposal designed by De Aguiar and Correia (2013) The length of the training for the...

Ngày tải lên: 10/01/2020, 06:44

... counting on you to send me the information by the end of the day 2.4 The use of phrasal verbs Phrasal verbs appear in all aspects of language use, especially in written form of communication In the ... meanings of fully idiomatic phrasal verbs because they have new meanings, which cannot be deduced from the meanings of each part in the combination Some examples of “take+particle” (Oxford Advanced ... English have a wide range of variability in syntax and semantics The fact that phrasal verbs have various variabilities in syntax and sematics makes students who learn English as second language face...

Ngày tải lên: 10/01/2020, 09:30

... more instruc-tion and training than therapists in training Associations between training and exposure use Table 4 presents all Spearman correlations for type of training received and the use of ... Acquisition of data: DS, Analysis and interpretation of data: DS, AVM Drafting of the manuscript: DS Critical revision of the manuscript and approval of the manuscript for publication: DS, AVM All authors ... such barriers, indicating that additional instruction and training might also help the dissemination of exposure therapies With 60 % of the respondents rating their postgraduate training as sufficient,...

Ngày tải lên: 10/01/2020, 14:51

... computer data transfer 3.1.2 ISDN Integrated Service Digital Network (ISDN) basically is a framing format that allows data to be carried at a range of data rates across a bearer ISDN makes use of the ... audio broadcasting and digital terrestrial TV broadcasting For a detailed discussion of this approach, see [1] This approach has the advantage that each transmitted data stream is narrowband and does ... marks have been appropriately capitalized Artech House cannot attest to the accuracy of this information Use of a term in this book should not be regarded as affecting the validity of any trademark...

Ngày tải lên: 24/08/2014, 17:22

... GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG...

Ngày tải lên: 18/02/2014, 14:20