the subject and the object of a sentence

... evaluation of the Polar parallel object database system, focusing in particular on the performance of parallel join algorithms Polar is a parallel, shared-nothing implementation of the Object Database ... (ODBMSs) are now established as the database management technology of choice for a range of challenging data intensive applications Furthermore, the applications associated with object databases ... Trang 1Measuring and modelling theperformance of a parallel ODMG compliant object database server Sandra de F Mendes Sampaio1, Norman W Paton1,∗,†, Jim Smith2and Paul Watson2 1Department of

Ngày tải lên: 17/03/2014, 00:20

... support to MFIs amongst lower income populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower ... including educational, communal, cultural, political and economic facets The questionnaire also evaluated the level of awareness about MFIs, availability and accessibility to MFIs, and impact of Government ... Bangladesh, Zambia and Bolivia, it can be inferred that such initiatives can also encourage small and medium sized profitable business establishments in the rural and remote areas of Pakistan

Ngày tải lên: 06/09/2013, 05:48

... Vaaje-Kolstad et al containing 100 lm of (GlcNAc)1–4 was analysed at the start, in the middle and at the end of each series of samples The resulting average values of the standards (displaying standard ... instructions, containing ends compatible with the expression vector (forward primer, 5¢-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3¢; reverse primer, 5¢-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3¢) The PCR product ... gain access to and degrade individual polymer chains First, the chains are degraded by both endochitinases, that attack the chitin chain randomly, and exochitinases, that attack the chitin chains

Ngày tải lên: 18/02/2014, 08:20

... dextran-a-CT conjugates at pH 7.1, 25 C. (kcalÆmol)1) Lac-a-CT a Dex-a-CT a a Average moles of lactose and dextran per mole of a-CT b Aiare the fractions of amide protons in the i th population ... equal to k cat for the hydrolysis of Suc-AAPF-SBzl. Lac-a-CT Dex-a-CT Trang 8were independent of the size of the glycan (Tables 2and 5, [36]) The analysis revealed that the changes in these parameters ... can certainly be observed from the analysis of the MD trajectories (Fig S4 and Table S4), these changes are not necessar-ily relevant to the changes in catalysis as the timescales that are accessible

Ngày tải lên: 19/02/2014, 05:20

... |  Annexes Family Schizaeaceae Schizaeaceae Lycopodiaceae Selaginellaceae Gnetaceae Araceae Araceae Araceae Araceae Araceae Araceae Araceae Araceae Arecaceae Arecaceae Arecaceae Arecaceae Arecaceae ... Biodiversity and Local Perceptions  |  97 Family Arecaceae Arecaceae Arecaceae Arecaceae Arecaceae Arecaceae Arecaceae Arecaceae Arecaceae Arecaceae Arecaceae Arecaceae Arecaceae Arecaceae Arecaceae Commelinaceae ... and Local Perceptions  |  99 Family Hypoxidaceae Marantaceae Orchidaceae Orchidaceae Pandanaceae Pandanaceae Pandanaceae Pandanaceae Phormiaceae Poaceae Poaceae Poaceae Poaceae Poaceae Poaceae

Ngày tải lên: 21/02/2014, 04:20

... more antibacterial than dermaseptin (34 amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a-helical part having the four amino acids LAKK identical to mastoparan) and ... explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial activity against Gram-negative ... mastoparan gave the same results The role of LPS in the interaction was also demonstrated by the lack of effect of extracellular Mg2+ on the activity of the peptides against Gram-positive bacteria

Ngày tải lên: 21/02/2014, 15:20

... Malaysian coastal and marine resources off the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and rank those ... Kalimantan Kuala Lumpur, the national capital, Labuan Trang 12and Putra Jaya form the Federal territories The multiracial population of Malaysia is composed of 58 percent bumiputra (Malays and ... and an Exclusive Economic Zone of 450,000 km2 Economic Setting Malaysia consists of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan

Ngày tải lên: 06/03/2014, 15:21

... companies), compete on the basis of brands and reputation, and make substantial use of natural resources These results have implications for investors that integrate environmental and social data ... operate is more secure and that they might be able to attract better employees and more loyal customers from these areas.3 On the other hand, scholars have argued that adopting environmental and ... Copies of working papers are available from the author The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance Robert G Eccles, Ioannis Ioannou, and George Serafeim

Ngày tải lên: 06/03/2014, 20:21

... understood, not as an introspectiveEuropean act of examination, explanation and analysis of particular post-national assaults on the leading paradigms of modernity, but, rather, as aneffort to deploy ... 88III The reference procedure and the making of the IV Judges, lawyers and the source of the force of law 97 I Lawyers, (self-) illusion and the making of the II The formalist narrative of European ... Seeing into the mind of European law ‘Seeing into the mind of law and lawyers’ is not an easy task In particular,and as a part of its integral vocation to remain ‘apart’ from the society that it serves,

Ngày tải lên: 07/03/2014, 02:20

... min; then a final extension at 72 C for 10 min The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank ... sequences of lac1 and other fungal laccases *, Amino acid conserved among all of the sequences Ten His residues and one Cys residue represent the amino acids that serve as Cu 2+ ligands and are shown ... XYL, FA and VA all induced extracellular laccase production in P sajor-cajuand transcription levels of three laccase genes were increased by FA and XYL [5] Higher levels of laccase mRNA were also

Ngày tải lên: 07/03/2014, 15:20

... in the era of the global popular film market, is also a magic word At once a place in Los Angeles, an industrial marker and a mythical land, it is emblematic of contemporary cinema’s contradictory ... Bette Davis, Henry Fonda, and Karl Malden) And since these magical beings are watching and clapping along with a (newly) global “us” in the virtual audience, all the more reason the montage must ... informational barrage and the Trang 7increase in fast-paced commercials of the post-MTV era make such moves seem natural and inevitable In Workman’s montages, audiences are encouraged to congratulate

Ngày tải lên: 07/03/2014, 15:20

... contain a KH domain RNA analysis and blast analysis indicated that homologs and orthologs of VBARP exist, indica-ting the presence of VBARP in diverse phyla such as plants, yeast, and eukaryotes These ... regulators of apoptosis [12,13] Caspases are rou-tinely used as a measure of apoptosis, in contrast to necrosis Caspase 3 activation occurs at the intersec-tion of all caspase-dependent pathways and ... specific The input panel represents the amount of protein used in this assay indicating that an equal amount of protein was used in all our samples and that the lack of interaction between VBARP and

Ngày tải lên: 07/03/2014, 21:20

... control at t¼ 0 for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact peptide at t¼ 0 and t ¼ 60 min Binding assays Binding assays were carried ... agonist and antagonist structures [21–23] By molecular mechanics calculations the conformers of Ac-HGly-NHMe, Ac-b2-HAla-NHMe and Ac-b3 -HAla-NHMe have been generated and compared to the canonical ... that Ca chemical shifts are sensitive to solvent variation, causing an under-estimation of calculated CSDs These CSDHaand CSDCa variations demonstrate the formation of more stable and abundant

Ngày tải lên: 08/03/2014, 08:20

... that antibodies mayhave been partiallyinduced against the linear isoform of the HNE peptide Although the binding pattern maybe somewhat blurred bythese antibodies and bythe polyclonal nature of ... coating, the HNE peptide was at least partiallyoxidized and the signal of the reduced species increased as a result of oxidation Identification of the active isoform Because of disulfide scrambling ... BIAEVAL-UATION3.01 software The relative R values (RUrel) were obtained bynormalizing the calculated Reqvalues with the average Reqvalue measured with mAb BH216 alone The chips were washed and

Ngày tải lên: 08/03/2014, 08:20

... adamalysin II (cyan) and atrolysin C (blue) after the binding of a phosphonate inhibitor and the batimastat, respectively [26,47].(E) and (F), the S)1pockets of the catalytic proteinase domain ... domain of TNFa converting enzyme (green) and human neutrophil collagenase (magenta) after the binding of a hydroxamate and a barbiturate inhibitor, respectively [22,46].All these diagrams are in the ... shchiou@gate.sinica.edu.tw and A.H.-J.Wang, Institute of Biological Chemistry, Academia Sinica, Nankang, Taipei, Taiwan. Fax: +886 227882043, E-mail: ahjwang@gate.sinica.edu.tw Abbreviations:

Ngày tải lên: 08/03/2014, 23:20

... CCCTATAGTGAGTCGTATTA T7 Promoter (R) CAGGAAACAGCTATGAC PLA5G (F) CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG PLA3G (R) CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG PLA5G1 (F) AGGAYTCTCTGGATAGTGG PLA3G1 (R) CTCACCACAGACGATWTCC ... CTCACCACAGACGATWTCC PLA5G2 (F) CGGTAAGCCCATAACGCCCA PLA3G2 (R) CAGGCCAGGATTTGCAGCC PLA3G4 (R) CATAAACAYGAGCCAGTTGCC AtxBF b (F) GCCTGCTCGAATTCGGGATG AtxBrcb(R) CTCCTTCTTGCACAAAAAGTG AtxACFc(F) ... equivalent exon in the other PLA2 genes (Table 3) The ammodytoxin C, dytins I1 and I2 and ammodytin L genes of V am ammo-dytes, the VP7 and VP8 genes of V palaestinae, and the PLA2 genes of Crotalinae

Ngày tải lên: 17/03/2014, 03:20

... innovation: they also draw attention to the balance of advantage and disadvantage. We need to make both the opportunities and risks of new technologies as transparent as possible in a broad dialogue ... that dominate the economy. This is apparent in the high innovative capacity of Sweden, Finland and Ireland and the low innovative capacity of Greece and Portugal. Of course, this shift towards ... four years which explains the fact that the available data dates back to 1996. A cross-country comparison of the innovation indicators can help identify national strengths, and areas of weaknesses...

Ngày tải lên: 16/01/2014, 16:33

... other Roland and the other Renaud, the Orlando of Ariosto and the Rinaldo of Boiardo. The traitor Ganelon has enabled King Marsile to overtake with all his heathenness the rear-guard of Charlemagne ... Corombonas, and Annabellas and Giovannis, creatures for Webster and Ford; and because this world of chivalry is, in his Italy, as false as the world of Amadis and Esplandian in Toboso and Barcelona for ... everyday life of Ariosto and Shakespeare, and with a strange fancy for fairyland, for the distant, for the Happy Islands, the St. Brandan's Isles, the country of the fountain of youth, the...

Ngày tải lên: 21/02/2014, 21:20

... him that there were many other and larger bands of Danes in Mercia and Anglia, and that had he massacred the band at Exeter and this he could not have done without the loss of many men, as assuredly ... a Danish chieftain, had again advanced to Reading, and had captured and burned the town. The king marched against him, and the two armies met at Merton. Here another desperate battle took place. During ... blood of Mercia. The fact that they marched at the call of the King of Mercia and drove the Danes from Nottingham shows that the West Saxon princes are alive to the common danger of the country, and...

Ngày tải lên: 17/03/2014, 20:20

... pNAL1 and used for expression analysis. Truncated proteins were generated using the following primers: 2.1up, AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AA ACATATGCTTGTTCCTCAAAAACTTCC; ... ACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG. Construction of site directed mutants The mutated proteins D123W36 6A, D123Y39 4A and the double-modified ... MV, Palopoli N, Valdez HA, Fornasari MS, Wayllace NZ, Gomez-Casati DF, Parisi G & Ugalde RA (2008) Functional and structural characterization of the catalytic domain of the starch synthase...

Ngày tải lên: 22/03/2014, 21:20