the protective role of zinc in cancer a potential chemopreventive agent

Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc

Báo cáo Y học: The role of zinc in the methylation of the coenzyme M thiol group in methanol:coenzyme M methyltransferase from Methanosarcina barkeri New insights from X-ray absorption spectroscopy doc

... by a sulfur ligand in all zinc- containing MtaA proteins [i.e 2.0 (N/O) plus (S)] We interpret these results as indicating the binding of the thiol sulfur of HS-CoM to the zinc atom of MtaA in a ... Ala mutant at a zinc- sulfur distance of % 2.7 A In Cys239 Ala and His237 Ala, the pronounced changes in the EXAFS spectra resulting from HS-CoM addition are indicative of an increase in the ... (antisense); in the second mutant, Cys239 was exchanged for Ala using the primers 5ÂCGTGACTGT ACTCCACATCgcTGGTAAGGTTAACGC (sense) and 5ÂGCGTTAACCTTACCAgcGATGTGGAGTACAGTC ACG (antisense) The mutated bases...

Ngày tải lên: 17/03/2014, 23:20

7 468 0
Báo cáo y học: "4-Hydroxynonenal induces apoptosis in human osteoarthritic chondrocytes: the protective role of glutathione-S-transferase" doc

Báo cáo y học: "4-Hydroxynonenal induces apoptosis in human osteoarthritic chondrocytes: the protective role of glutathione-S-transferase" doc

... Hayakawa A, Suzuki H, Miyata T, Kurokawa K, Hotta Y, Ishikawa N, Nakashima I: 4-hydroxynonenal induces a cellular redox status-related activation of the caspase cascade for apoptotic cell death ... protected against HNE-induced DNA fragmentation PARP activation and AIF translocation to the nuclei during apoptosis are implicated on a large scale in DNA fragmentation and peripheral chromatin condensation ... Second, in investigating the classi- cal markers of apoptosis, we obtained data showing that HNE induced caspase-8, -9, and -3 activities and cleavage, AIF and cytochrome c release from mitochondria,...

Ngày tải lên: 09/08/2014, 13:21

11 397 0
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

... ACGTTGGATGAATCCCCGCAGACCATGACAC fwd ACGTTGGATGAGTCGGTAGCAACACCAGG rev ACGTTGGATGACCATGACACCTTCCTGCTG fwd ACGTTGGATGGGAGTGAAAAGATGTGCTGG rev ACGTTGGATGCCACTTCCTCTGCACAAATC fwd ACGTTGGATGAGAGAACTGGGTTAAGGCAG ... Primer Callrate (%) fwd ACGTTGGATGAAAATACTGGGACTCGAGGC rev ACGTTGGATGTGCTGTATCTATAGCCCTCC fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC ... ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC fwd ACGTTGGATGCTGCCCTTGATGATTCCAAG rev ACGTTGGATGGGAACATCACAGGAAATGAC fwd ACGTTGGATGTTCCCTTCTCCCTTCCCTCTC rev ACGTTGGATGTTGCTCAGCCCCAAAGATGG fwd ACGTTGGATGTTCCCTTCTCCCTTCCCTCTC...

Ngày tải lên: 12/08/2014, 16:20

12 358 0
Tài liệu The Fiscal Impact of Immigrants in Austria – A Generational Accounting Analysis ppt

Tài liệu The Fiscal Impact of Immigrants in Austria – A Generational Accounting Analysis ppt

... aggregated micro-data The macroeconomic data on revenues were taken from national accounts data in Statistik Austria (200 1a) and data from the Association of Austrian Social Insurance Institutions ... Fiscal data that are only available at the household level in the ECHP (that is, in our case, housing and social assistance benefits), are allocated to individuals by assuming that the total amount ... sustainable inter-temporally c Annual additional average tax payment per capita of native population balancing the inter-temporal budget constraint Note: Generational accounts for natives Base...

Ngày tải lên: 18/02/2014, 01:20

40 379 0
Báo cáo khoa học: "The key role of semantics in the development of large-scale grammars of natural language" pdf

Báo cáo khoa học: "The key role of semantics in the development of large-scale grammars of natural language" pdf

... arguments; (iii) if an EP has three arguments, then one of them is a state -of- affairs, and another is an undergoer coindexed with an argument of the embedded stateof-affairs Finally, as far as ... which the achievement of such a goal can be based realistically A presentation of the technical details of the LKB implementation of the grammar fragment that we have described above, which practically ... approaches to verbal alternations in particular and to development of (the lexicon of) large-scale computational grammars of natural language based on HPSG in general As an dmtc stands for directed_motion_to_contact...

Ngày tải lên: 17/03/2014, 22:20

4 481 0
CITY DIPLOMACY: THE EXPANDING ROLE OF CITIES IN INTERNATIONAL POLITICS potx

CITY DIPLOMACY: THE EXPANDING ROLE OF CITIES IN INTERNATIONAL POLITICS potx

... world, have a lot to gain as well from maintaining a certain image and attracting foreign capital An interesting aspect of this diplomatic game is the theory and practice of city branding – the notion ... autonomously in engaging in international political activities, a city in another country can be hindered by national law in its international aspirations At the same time, cities operate in the international ... countries such as Canada, Spain and Sweden; and that they are growing (Hawksworth, 2007: 15) Given the economic gains that come with such an image and position and the importance of maintaining them,...

Ngày tải lên: 24/03/2014, 21:20

45 360 0
Báo cáo khoa học: Analyzing the catalytic role of Asp97 in the methionine aminopeptidase from Escherichia coli potx

Báo cáo khoa học: Analyzing the catalytic role of Asp97 in the methionine aminopeptidase from Escherichia coli potx

... conserved aspartate in human prolidase by asparagine causes skin abnormalities, recurrent infections, and mental retardation [45] On the basis of ICP-AES analyses, both D9 7A EcMetAP-I and D8 2A PfMetAP-II ... origin software package This software package uses a nonlinear least-square algorithm that allows the concentrations of the titrant and the sample to be tted to the heat-ow-per-injection to an ... leads to the growth and proliferation of carcinoma cells In comparison to conventional chemotherapy, antiangiogenic therapy has a number of advantages, including low cellular toxicity and a lack...

Ngày tải lên: 30/03/2014, 02:20

12 331 0
The functional role of emotions in aesthetic judgment pot

The functional role of emotions in aesthetic judgment pot

... be labeled as aesthetic emotional states of pleasure The consideration of the aesthetic emotional state as a result of an appraisal process implies a dynamic organizational linkage of the aesthetic ... it appears that not only brain areas dominant in aesthetic judgments are engaged, but there is also the specific engagement of another area, which has a fundamental role in the processing of more ... pleasure in certain pure sensations and combinations of them In the primary layer a secondary layer can be added The secondary layer of pleasure offers the elegance in aesthetic taste However, James...

Ngày tải lên: 30/03/2014, 16:20

15 410 0
aging of the genome the dual role of dna in life and death mar 2007

aging of the genome the dual role of dna in life and death mar 2007

... impose the same condition on any acquirer British Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Data available Typeset by Newgen Imaging ... and the set of tRNAs charged with the appropriate amino acids to the ribosomes, discovered earlier as the protein-making apparatus in the cytoplasm The guiding role of Francis Crick in bringing ... proposed in 1963 that cellular aging involves the accumulation of defective proteins as a result of an inherent inaccuracy of the translational machinery This is generally known as the error catastrophe...

Ngày tải lên: 11/06/2014, 10:21

385 338 2
Báo cáo y học: "The expanding role of Tax in transcription" pdf

Báo cáo y học: "The expanding role of Tax in transcription" pdf

... factors In the case of HTLV-I, Tax has been shown not to associate with a CTD kinase [11] and a dominant negative mutant of cdk9 (the catalytic subunit of pTEFb) was found to increase Tax transactivation ... elongation, there is a switch in CTD phosphorylation to serine phosphorylation resulting in the loss of the capping machinery and the association of splicing, elongation and chromatin remodeling ... transactivators have been shown to have a role at initiation and downstream events, such as elongation The most notable of these has been Tat, the viral transactivator of HIV-1 Without cellular...

Ngày tải lên: 13/08/2014, 13:20

4 394 0
Characterization of the novel role of parkin in gliomagenesis

Characterization of the novel role of parkin in gliomagenesis

... malignant glioma would show an increase in the choline peak and a decrease in the N-acetyl aspartate peak as compared to unaffected areas of the brain (Fig 1. 4A) These metabolites level changes have ... onset in patients at the time of diagnosis is 64 years of age in the case of GBM and 45 years of age in the case of anaplastic gliomas (Fisher et al., 2007) About 5% of patients with malignant ... remains to be elucidated 1.10.3 Structure and Function of Parkin Structurally, the 465 amino acid-containing parkin protein is composed of several modular domains At the N-terminal of parkin, there...

Ngày tải lên: 10/09/2015, 08:25

182 338 0
Studies on the cytoprotective role of autophagy in necrosis

Studies on the cytoprotective role of autophagy in necrosis

... 2004) Interestingly, activation of caspases can be achieved via a signaling cascade in which certain caspases are cleaved by the upstream caspases to gain the proteolytic activity towards their ... domain (DED) or the caspase recruitment domain (CARD) The DED or CARD domain can direct the interaction of the initiator caspases with the upstream adaptor molecules, whereby the initiator caspases ... carried out by the Atg1 complex, consisting of Atg1, Atg13, and Atg17, downstream of the target of rapamycin (TOR) and cAMP-dependent kinase (PKA) pathways (Matsuura et al., 1997) The Atg1 kinase...

Ngày tải lên: 11/09/2015, 10:17

229 348 0
báo cáo hóa học:" Role of CA125 in predicting ovarian cancer survival - a review of the epidemiological literature" pptx

báo cáo hóa học:" Role of CA125 in predicting ovarian cancer survival - a review of the epidemiological literature" pptx

... survival estimation of female patients with relapsed ovarian carcinoma In multivariate analysis only the variation of blood levels of CA125 and the free disease interval from the finalization of the ... Mano A, Falcao A, Godinho I, Santos J, Leitao F, de Oliveira C, Caramona M: CA-125 AUC as a predictor for epithelial ovarian cancer relapse Cancer Biomark 2008, 4:73-81 Mano A, Falcao A, Godinho ... paclitaxel/cisplatin as primary treatment for advanced epithelial ovarian cancer: a National Cancer Institute of Canada Clinical Trials Group Study J Clin Oncol 2000, 18:4038-4044 Jacobs IJ, Skates SJ, MacDonald...

Ngày tải lên: 20/06/2014, 07:20

20 508 0
Tài liệu THE ROLE OF UNIVERSITIES IN REGIONAL INNOVATION SYSTEMS - A NORDIC PERSPECTIVE pdf

Tài liệu THE ROLE OF UNIVERSITIES IN REGIONAL INNOVATION SYSTEMS - A NORDIC PERSPECTIVE pdf

... strengthen the technical learning ability of the economy in a period of radical technical change They concluded that the capability of national economies to learn abou, adapt and change their instiutional ... innovation are increasingly being framed within an international arena The links between sub-regional, regional, national and international systems of innovations imply hat analyses should include ... the Faculty of Arts and the Faculty of Medicine in 1935, the Faculty of Economics and Law in 1936, the Faculty of Theology in 1942 and, finally, the Faculty of Science in 1954 The main reason...

Ngày tải lên: 16/01/2014, 16:33

180 597 1
Tài liệu Báo cáo khoa học: A possible role of mitochondria in the apoptotic-like programmed nuclear death of Tetrahymena thermophila Takashi Kobayashi and Hiroshi Endoh docx

Tài liệu Báo cáo khoa học: A possible role of mitochondria in the apoptotic-like programmed nuclear death of Tetrahymena thermophila Takashi Kobayashi and Hiroshi Endoh docx

... higher in fractions and than in fraction (Table 1) These results indicate that fraction contains a significant number of mitochondria, and that fraction is the main lysosomal fraction The DNAcleavage ... mitochondria in this process [19] In mammalian apoptosis, caspase-8 and caspase-9 are known to be associated with the mitochondrial pathway Active caspase-8 induces the release of mitochondrial apoptosis ... by Lu and Wolfe [23], who used a combination strategy of 4,6-diamino-2-phenylindole (DAPI) staining for the detection of DNA and Azo dye staining for the identification of acid phosphatase activity,...

Ngày tải lên: 20/02/2014, 03:20

10 646 0
TMJ Disorders and Orofacial Pain The Role of Dentistry in a Multidisciplinary Diagnostic Approach pptx

TMJ Disorders and Orofacial Pain The Role of Dentistry in a Multidisciplinary Diagnostic Approach pptx

... Pain Polarizing discussions during the past 10 years have made the role of the dentist in diagnosing and treating pain in the head and neck region increasingly obscure rather than more clear In ... neuralgia Herpes zoster Peripheral neuritis Neurovascular pain Vascular pain Episodic pain Paroxysmal neuralgia Glandular, ocular, and auricular pain Pulpaf pain Viscera! pain Visceral mucosal pain ... Cluster headache Paroxysmal unilateral headache Neurovascular variants Arteritis pain Carotidynia joint surface pain Retrodiscal palm Capsule pain Ligament pain Arthritic pmn Myofascial pain Myositis...

Ngày tải lên: 06/03/2014, 11:20

379 1,2K 0
The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc

The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc

... study of 3260 enrollees in a national managed care organization in the United States, that 23% of the English-speaking and 34% of the Spanish-speaking respondents could not adequately read and ... than words alone However, words are still important in explaining the implications of the pictures and in explaining what is happening in the pictures This hypothesis includes the same qualification ... Koplan JP Health literacy among medicare enrollees in a managed care organization JAMA 1999; 281:545–51 [10] International Reading Association, Special Interest group on reading and readability...

Ngày tải lên: 14/03/2014, 21:20

18 922 0
Báo cáo khoa học: Adenine and adenosine salvage pathways in erythrocytes and the role of S-adenosylhomocysteine hydrolase A theoretical study using elementary flux modes Stefan Schuster and Dimitar Kenanov ppt

Báo cáo khoa học: Adenine and adenosine salvage pathways in erythrocytes and the role of S-adenosylhomocysteine hydrolase A theoretical study using elementary flux modes Stefan Schuster and Dimitar Kenanov ppt

... is involved in these pathways Since adenine is a substrate of ADPRT, the elevation of ATP in the absence of adenosine kinase shows that adenine must be released in the process before being incorporated ... mentioned in the Introduction that patients deficient in ADPRT are accumulating adenine [8–11] The modes of adenosine salvage (Table 3) all require AK, so that they are not operative in the case of AK ... predict that there is redundancy both in adenine salvage and in adenosine salvage in that parallel pathways producing ATP from each of these substrates exist While the metabolism of many cells...

Ngày tải lên: 30/03/2014, 20:20

13 480 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

... this time the valency hybrid tetramers As a result, the b chain was found to acquire a noticeable resistance against the acidic autoxidation in a manner of contacting with the a chain, no matter ... state the partner a chains may take, the oxy-form or the ferric met-form Unlike separated b chains, the spontaneous formation of hemichrome was at variance with separated a chains in the pH range ... isolated a chain In contrast to this, the heme pocket of the b chain still obstructs easy access of a water molecule as well as a proton, so that the b chains can keep a constant resistance against...

Ngày tải lên: 31/03/2014, 15:20

10 651 0
w