the mind as machine metaphor does not cover everything

... asks about mental processes and/or about how the mind/ brain works (That doesn’t prevent them asking also whether the emphasis on the mind/ brain is too great: some say we should consider the mind or ... some of the first programs for the full version of the Manchester machine had worked there also As early as 1949, Emmet’s philosophy seminar had discussed The Mind and the Computing Machine , ... since they deny the possibility of any scientific explanation of mind And some, such as Johann von Goethe, are highly unfashionable to boot Other authors recounting the history of the field might not...

Ngày tải lên: 11/06/2014, 10:12

... and was modified to include a TEV Protease recognition site at the C-terminus of thioredoxin [32] The integrity of all clones was assessed by full-length sequencing of the respective plasmids ... RT RNase H upon titration with unlabeled RT or HuR Furthermore, HuR did not affect the kinetics of HIV-1 reverse transcription in vitro Taken together, our results suggest that HuR does not impact ... to exist as monomers in solution and the molecular masses of NusA-HuR and NusARRM were determined as 82.2 and 68.9 kDa, respectively These values are within ± 15% of the predicted masses of 99...

Ngày tải lên: 12/08/2014, 23:23

... Positions of the FISH probes are indicated by red bars When a plasmid expressing a DsRed-tagged Rev was cotransfected together with Tat (without tag), the unspliced RNA was found in the cytoplasm, consistent ... and the parental HOS_143b we realized that expression of HMBOX1 was affected by the presence of Tat per se and not by the activation of the viral LTR (Figure 4F and Figure 4G) This effect was not ... was similar to the number of those where instead HMBOX1 was active (Figure 6D) Another important finding of this work was that in some cells expression of the endogenous HMBOX1 gene and of the...

Ngày tải lên: 13/08/2014, 05:21

... analyzed to measure the length of the processes The sum of the lengths of all the measured processes was divided by the number of cells Cells with no process were excluded from the analysis At ... recognized as an essential process during the elongation of neurites, presumably to assure cell asymetry and the transport of materials to the growth cone Consistently, this process of stabilization has ... most of the protein in brain samples was found in the 7114 pellet, whereas, in dCAD cells samples, no MAP band was observed (not shown) Gene and mRNA analyses of MAP1b, MAP2, Tau, and STOP The finding...

Ngày tải lên: 23/03/2014, 05:22

... cannot be addressed by a further extension of the present theory, by the framework of the agency theory and the theory of asymmetric information The question goes into the heart of the present theory, ... approaches of these theories is that the corporate enterprise is not treated as a “black box”, a uniform entity, as was the case in the traditional micro-economic theory of the firm It is regarded as a ... seen as a form of market imperfection The mainstream theory of the firm evolved under the paradigm of the agency theory and the transaction costs theory as a theory of economic organization rather...

Ngày tải lên: 24/10/2012, 09:11

... What does she think about the plan? V Give the correct form of the verbs in the blankets: 10 The Moon (move) ………………………………… … around the Earth The children ... VII Choose and underline the best answers: The weather is warm enough for us ………………………………… … (going out- to go out- go out- goes out) The earth the Earth, the Sun, and the Moon are ……………………………… ... friends – things) They always help their mother ………………………………… … .the house work (do –to - doing – done) I………………………………… ….very happy on my last vacation ( am –is – was – were) Ba’s brother …………………………………...

Ngày tải lên: 08/07/2013, 01:27

... were found to be of the fast-type in PV– ⁄ – fast-twitch muscles In addition, the total activity of sarcoendoplasmic reticulum Ca2+ATPase (SERCA) was unchanged [16] The increased mitochondrial ... genotype) An up-regulation of that order is found for both COX isoforms, as well as for cytochrome c On the other hand, the up-regulation of F1-ATPase b was clearly smaller and comparable to the ... mitochondria resulting from the absence of PV in fast-twitch PV– ⁄ – TA is not the result of a simple increase of all mitochondrial constituents Based on the increased mitochondrial volume in...

Ngày tải lên: 19/02/2014, 07:20

... whereas the other half was kept in the dark to serve as a negative control The TAG-codons at both positions were efficiently suppressed by (Tmd)Phe-tRNAsup (data not shown), resulting in nascent ... than the 57-mer (Fig 2B, compare lanes and 7) Together, the data suggest that nascent SufI leaves the ribosome via the major ribosomal exit site and that, upon extension of the nascent chain, the ... IMVs were added during synthesis of nascent Tat proteins, crosslinking to the Tat translocase was not observed irrespective of the presence of TF (data not shown) Also, the lack of significant effect...

Ngày tải lên: 07/03/2014, 16:20

... Ca2+ release from intracellular stores The role of NAD+ in Wallerian degeneration has emerged since the discovery of the Wld S gene, where the full coding sequence of Nmnat1 is fused to the 5¢ ... background The K14 Cre induces a full deletion when bred from the female as K14 is expressed in the oocyte [27] The offspring of this cross had recombination between the two loxP sites; therefore the ... between the second and the third loxP sites, part of promoter and the first two exons of the gene would be disrupted Even in the unlikely event that a truncated protein lacking these two exons was...

Ngày tải lên: 22/03/2014, 16:20

... To test whether the mutation abolishes the expression of C14SR, RNA was extracted from liver and the cDNA was synthesized by RT-PCR using the forward and reverse primers that amplify the entire ... in the presence of the C27D8,14 sterol substrate Activity was measured on the basis of C27D8 formation and C27D8,14 disappearance, evaluated as the peak area ratio between the individual sterol ... < 0.05) Nevertheless, no difference in their expression was found in the liver of Tm7sf2() ⁄ )) mice Discussion The discovery that inborn errors in cholesterol biosynthesis are the cause of human...

Ngày tải lên: 23/03/2014, 06:20

... intensity was located at the same position as after washing at pH 7.4, indicating that the different pH values of the buffers used in the incubations did not affect the size or the morphology of the ... was determined and compared to the mean fluorescence in R1 after washing at pH 5.4 In the case of LpR, the fluorescence of cells washed at pH 5.4 was 94.3 ± 7.6% of the fluorescence of cells washed ... decrease of the number of cells in R1 As this reduction in sample size introduced a bias into the analysis, the number of cells in the analysis was restored by using random measurements from the...

Ngày tải lên: 23/03/2014, 07:20

... been classified as manslaughter The Court found no violation of Article It was not currently desirable or possible to rule on whether an unborn child was a person under Article And, there was no ... concerning the other two), because she was unable to establish her right to a legal abortion either through the courts or the medical services available in Ireland The Court noted the uncertainty ... deformed and the results of the amniocentesis, too late for her to make an informed decision on whether to continue the pregnancy or to ask for a legal abortion, as the legal time limit had by then expired...

Ngày tải lên: 28/03/2014, 16:20

... diseases fish + diseases fish ^ diseases Click on your answer What does CDS/ISIS offer? The ways of searching also depend on the database design, so these are defined by the database developers For ... languages and scripts Let’s review together the importance that these functionalities have for the user… What does CDS/ISIS offer? Macroeconomía y políticas agrícolas: una guía metodológica ... defined as repeatable 3) If the names have been stored appropriately, it can render them in different ways Database management systems - Textual databases and cds/isis basics – page What does CDS/ISIS...

Ngày tải lên: 31/03/2014, 20:20

... pCRII-hNIS-1 as the template The respective PCR products were then mixed and used as the templates in one reaction with hNIS-5 and hNIS3 as the primer pair The final PCR product was again cloned into the ... by replacing the b-glucuronidase (gusA) expression cassette at the A56R locus with the hNIS expression cassette (SE-hNIS) containing the hNIS cDNA under the control of the VACV synthetic early ... been shown not to be the case with some other viruses such as adenoviruses [1] It has fast and efficient replication, and cytoplasmic replication of the virus lessens the chance of recombination...

Ngày tải lên: 18/06/2014, 19:20

... genes can alter the environmental microbiota Nevertheless, we ignore whether part of these alterations might remain over the long term Whereas antibiotics are degraded in nature, the genetic platforms ... doi:10.1186/2190-4715-23-1 Cite this article as: Taube F, et al.: The booklet „Genetically modified crops“, published from the German Research Foundation, does not meet the given claim – Discussion article ... umfassende und auch kritische Aspekte reflektierende Bestandsaufnahme als die vorliegende Broschüre der DFG Weiterhin wird die Unausgewogenheit der Behandlung des Themas auch an einzelnen Themenausschnitten...

Ngày tải lên: 21/06/2014, 06:20

... Total RNA (1.0 mg) was synthesized by using the 1st strand cDNA synthesis kit (Boehringer Mannheim, Germany) following the manufacturer’s instruction The PCR mixture was made as the following: 0.15 ... was immediately recovered by a midline incision Caudal epididymis and vas deferens were dispersed, dissected free of the epididymis and surrounding fat, and washed in media The epididymis was ... significantly increased PHGPx mRNA expression in the epididymis, compared to the control (p < 0.05) The PHGPx expression in the epididymis was much higher by genistein than by 17β-estradiol (Fig 5) There...

Ngày tải lên: 07/08/2014, 18:20

... cardiac study and for the present biological evaluation The second evaluation was carried out in the morning, hour after the last intake of nifedipine The study was approved by the local Ethics Committee ... follow-up of the disease SSc was classified as 'limited' or 'diffuse' cutaneous according to the criteria of LeRoy and colleagues [18] The exclusion criteria were the impossibility of stopping vasodilator ... ng/ml for sVCAM-1 Materials and methods The onset of the disease was defined as the time at which skin involvement occurred The laboratory tests included the Westergren erythrocyte sedimentation...

Ngày tải lên: 09/08/2014, 01:23

... GATCCACAGCAACTCCAGAA The volume was adjusted to 15.5 μl using RNase-free water, and the mixture was then incubated for 10 minutes at 70°C to denature the total RNA The sample was then incubated for ... was added to the sample The whole mixture was incubated at 46°C for first-strand synthesis After one hour the temperature was increased to 70°C for 15 minutes to terminate the reaction U RNase ... Carlsbad, CA, USA) was then added to degrade the RNA After RNase treatment the temperature was increased to 70°C to inactivate RNases All samples were then diluted with RNase-free water to a...

Ngày tải lên: 09/08/2014, 10:23