the cardiac atlas project towards a map of the heart

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

... 3B) Again, these changes were abolished in female db ⁄ db heart mitochondria Together, these data suggest that the greater reliance of female murine cardiac mitochondria on glucose than on fatty ... employed a mixture of mm malate and 25 lm palmitoyl-l-carnitine as oxidative substrates State respiration (resting) was measured after addition of oxidative substrates, and state respiration after the ... addition of 300 lm ADP to the electrode chamber To test the ability of mitochondria to withstand oxidative stress, mm ADP was added after state respiration, and the chamber was closed and sealed...

Ngày tải lên: 18/02/2014, 16:20

7 583 0
báo cáo hóa học:" Right thoracic curvature in the normal spine" pdf

báo cáo hóa học:" Right thoracic curvature in the normal spine" pdf

... healthy subjects to undergo radiographic examinations because of the unnecessary exposure to radiation and the ethical problems The other limitation of the study is the lack of sagittal profile ... analysis and interpretation of data, and drafting the manuscript KH, HM, and YM performed part of literature review KM and KK performed part of acquisition of data YI participated in design and ... correlation coefficient was calculated Numerical value shows the gamma of interclass correlation coefficient and the range of the 95% confidence interval Page of Table Intrerobserver reliability analysis...

Ngày tải lên: 20/06/2014, 04:20

5 354 0
Báo cáo hóa học: " Research Article Modeling On-Body DTN Packet Routing Delay in the Presence of Postural Disconnections" ppt

Báo cáo hóa học: " Research Article Modeling On-Body DTN Packet Routing Delay in the Presence of Postural Disconnections" ppt

... [8–11] as reported in the literature Note that the variation of the range is caused due to the variability in antenna orientation, clothing, and other on-body RF attenuation characteristics The ... (http://www.xbow.com/) The Mica2Dot nodes run from a 570 mAH button cell with a total sensor weight of approximately 10 grams The default CSMA MAC protocol is used with a data rate of 19.2 kbps Via software adjustments ... (PD) at the sink node On its way to the sink node, a data packet collects the entire route information in the form of a list of the intermediate node-IDs This allows the extraction and analysis of...

Ngày tải lên: 21/06/2014, 11:20

19 351 0
Báo cáo hóa học: " On the Compensation of Delay in the Discrete Frequency Domain" pot

Báo cáo hóa học: " On the Compensation of Delay in the Discrete Frequency Domain" pot

... necessarily the case in applications that require a delay to be applied to the signal The ability to effect delay is important in applications such as channel equalisation, echo cancellation, and the ... that of an FIR filter For equalisation of a linear delay channel, a filterbank FDAF can require in excess of an order of magnitude more bins than the number of taps required by a FIR filter The ability ... such as LMS [1] Let the delay that the transmission channel has imposed on the kth filterbank bin of the primary signal be denoted by If the filterbank decimates the time domain data by a factor of...

Ngày tải lên: 23/06/2014, 01:20

11 309 0
Báo cáo khoa học: "Injurious mechanical ventilation in the normal lung causes a progressive pathologic change in dynamic alveolar mechanics" potx

Báo cáo khoa học: "Injurious mechanical ventilation in the normal lung causes a progressive pathologic change in dynamic alveolar mechanics" potx

... outlined and the area at peak inspiration (I) and end expiration (E) was measured using image analysis software Alveolar stability was assessed by the percentage change in the area of individual alveoli ... fields were analyzed in each animal at each timepoint A mean of 38 alveoli (range 8–65) per timepoint per animal was analyzed The large range was due to alveolar collapse (atelectasis) in the HP/LP ... complete tidal breaths Image analysis of alveoli We analyzed the alveolar mechanics by replaying the video frame-by-frame and capturing still images of individual alveoli at peak inspiration (I) and...

Ngày tải lên: 13/08/2014, 03:21

9 277 0
Báo cáo y học: "Morphological characterisation of portal myofibroblasts and hepatic stellate cells in the normal dog liver" pptx

Báo cáo y học: "Morphological characterisation of portal myofibroblasts and hepatic stellate cells in the normal dog liver" pptx

... Diagn Invest 2000, 12:307-311 Sako T, Shimoyama Y, Akihara Y, Ohmachi T, Yamashita K, Kadosawa T, Nakade T, Uchida E, Okamot M, Hirayama K, Taniyama H: Neuroendocrine carcinoma in the nasal cavity ... variability regarding time of postmortal sampling and fixation, the age of the paraffin blocks, and age, sex and breed variation of the animals However, the used material reflects similar variability ... expression profiles All HSC express vimentin (rat), desmin (rat) and actin (man and rat), but alpha-smooth muscle actin (α-SMA) is classically considered as an indicator of activation (man and rat) [6,9,11]...

Ngày tải lên: 13/08/2014, 13:20

9 286 0
Báo cáo y học: " Cardiac effects of induction agents in the septic rat heart" potx

Báo cáo y học: " Cardiac effects of induction agents in the septic rat heart" potx

... text, tables and figures are displayed as means ± standard error of the mean Raw data from each functional and metabolic variable were compared by analysis of variance with repeated measures ... human disease by activating proand anti-inflammatory pathways Another limitation of this study is that in addition to cardiac depression, induction agents also induce a systemic vascular dilatation ... etomidate is also associated with a decrease in systolic arterial blood pressure in animal models and patients with advanced age and heart disease [21] In contrast, s(+)ketamine showed cardiac functionality...

Ngày tải lên: 13/08/2014, 19:20

8 286 0
Tài liệu IN THE HEART OF AFRICA pptx

Tài liệu IN THE HEART OF AFRICA pptx

... (cow of the desert) After sixteen hours' actual marching from Cassala we arrived at the valley of the Atbara There was an extraordinary change in the appearance of the river between Gozerajup and ... a good hygeen, or dromedary, and a baggage-camel, as between the thoroughbred and the cart-horse; and it appears absurd in the eyes of the Arabs that a man of any position should ride a baggage-camel ... Arabs Their patterns have never changed, but the water-jar of to-day is of the same form as that carried to the well by the women of thousands of years ago The conversation of the Arabs is in the...

Ngày tải lên: 15/02/2014, 09:20

219 336 0
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

... 5Â-GATCA TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3Â; LSYTRF, 5Â-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3Â The complementary sequences were used as ... apical and basolateral compartments of the culture dishes The MDCK cell monolayer provides a barrier between the apical and basolateral compartments The voltage drop over the membrane was measured ... cross the monolayer via the paracellular pathway, thus the accumulation of dye on the basolateral side represents paracellular ux Accumulation of the dye was determined by taking 25 lL aliquots every...

Ngày tải lên: 23/03/2014, 04:20

14 436 0
The French in the Heart of America doc

The French in the Heart of America doc

... coast of South America, and, still another is in waiting at the western terminus of the Panama Canal to assist the ships across the Pacific A fair regularity and reliability of rainfall have made ... Europe into America They were travelling over the edge of Champlain's map, away from Europe, away from Canada, away from the Great Lakes As far as that trail which led through the grass and reeds ... Plymouth, and the accurate mapping of all that coast now so familiar; there were the arrivals of the ship Jonas once with temporal supplies and again, as the Mayflower of the Jesuits, with spiritual...

Ngày tải lên: 31/03/2014, 13:20

160 502 0
báo cáo hóa học: " Measuring health-related quality of life in Hungarian children with heart disease: psychometric properties of the Hungarian version of the Pediatric Quality of Life Inventory™ 4.0 Generic Core Scales and the Cardiac Module" pptx

báo cáo hóa học: " Measuring health-related quality of life in Hungarian children with heart disease: psychometric properties of the Hungarian version of the Pediatric Quality of Life Inventory™ 4.0 Generic Core Scales and the Cardiac Module" pptx

... 6.28% of the sample Distribution of all participants in terms of gender and age group is shown in Table Statistical analysis Feasibility Feasibility of the Hungarian version of the Cardiac Module ... congenital heart disease (such as isolated small or repaired atrial and septal defect without residua), congenital heart disease with moderate complexity (for example, coarctation of the aorta, moderate-tosevere ... unit aged 5-18 years and 254 parents of children aged 2-18 years It was the mother who answered the questionnaire in 92.52% of the sample, and it was the father in 7.48% of the sample No parent...

Ngày tải lên: 18/06/2014, 19:20

12 621 2
Báo cáo sinh học: " Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" doc

Báo cáo sinh học: " Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" doc

... (Taiwan) Dog Hamam (Japan) (15) Dog Hamam (Japan) Dog KDK1 (Japan) (16) Dog KDK1 Dog Ueno (Japan) (17) Dog Ueno (Japan) Dog Yanaka (Japan) (18) Dog Yanaka (Japan) Giant panda (China) (19) Giant ... USA) (9) Raccoon (Michigan, USA) A7 5/17 (10) A7 5/17 Dog (Colorado, USA) (11) Dog (Colorado, USA) Javelina (12) Javelina Raccoon dog T dog Tanu (13) Raccoon anu (Japan) (Japan) Dog (T aiwan) (14) ... mortality in large felids [2], fresh-water seals (Phoca sibirica) [3], and various other animals CDV killed more than 10,000 Caspian seals (Phoca caspica) in year 2000 [4], and decimated an African...

Ngày tải lên: 18/06/2014, 22:20

14 347 0
báo cáo hóa học:" Structural ambiguity of the Chinese version of the hospital anxiety and depression scale in patients with coronary heart disease" doc

báo cáo hóa học:" Structural ambiguity of the Chinese version of the hospital anxiety and depression scale in patients with coronary heart disease" doc

... IA, Bajwa MA, Bhatti MR, Karim R: The translation and evaluation of an Urdu version of the Hospital Anxiety and Depression Scale Acta Psychiatr Scand 1991, 83:81-85 Malasi TH, Mirza IA, el Islam ... results of the CFA are summarised in Table and reveal that the two-factor model of Moorey et al [25] and the three-factor model of Dunbar et al [17] offered the best fit to the data The model ... manuscript CM participated in the design of the study, performed the statistical analysis and assisted in the drafting of the manuscript Acknowledgements All the authors would like to thanks the...

Ngày tải lên: 20/06/2014, 15:20

5 393 0
báo cáo hóa học:" Comparison of the SF-6D and the EQ-5D in patients with coronary heart disease" pdf

báo cáo hóa học:" Comparison of the SF-6D and the EQ-5D in patients with coronary heart disease" pdf

... performed the statistical analysis and drafted the manuscript EB conceived of the study and participated in it's design Both authors read and approved the final manuscript Acknowledgements Financial ... Comparison of maximal theoretical contribution to the utility score Comparison of maxim al theoretical contribution to the utility score Domains measuring the same area of health have similar colors ... study was provided in part by grant 2002B45 from the Netherlands Heart Foundation and in part by grant OG 98–026 from the Netherlands National Health Insurance Council The authors thank the Octopus...

Ngày tải lên: 20/06/2014, 15:20

9 409 0
báo cáo hóa học:" Mapping of the EQ-5D index from clinical outcome measures and demographic variables in patients with coronary heart disease" pptx

báo cáo hóa học:" Mapping of the EQ-5D index from clinical outcome measures and demographic variables in patients with coronary heart disease" pptx

... paper [14] The dataset was then divided in two by taking a random sample of 60% of the data and separating that data from the remaining 40% to provide an estimation dataset and a validation dataset, ... index as the dependent variable and age, sex and a proxy for disease stage as explanatory variables in the model using the estimation dataset The proxy 'disease stage' variable was created by taking ... http://www.hqlo.com/content/8/1/54 Page of 13 Table 3: Summary of categorical variables in estimation and validation datasets Variable Estimation dataset, n (%) Validation dataset, n (%) Mean (SD) EQ-5D (estimation dataset)...

Ngày tải lên: 20/06/2014, 16:20

13 335 0
Báo cáo toán học: " A note on the almost sure limit theorem for self-normalized partial sums of random variables in the domain of attraction of the normal law" pptx

Báo cáo toán học: " A note on the almost sure limit theorem for self-normalized partial sums of random variables in the domain of attraction of the normal law" pptx

... domain of attraction of the normal law, if there exist constants an > 0, bn ∈ R such that S n − bn d −→ N, an where N is the standard normal random variable We say that {Xn }n∈N satisfies the ... establish the ASCLT for self-normalized partial sums of random variables in the domain of attraction of the normal law, we will show that the ASCLT holds under a fairly general growth condition on dk ... A note on the almost sure limit theorem for self-normalized partial sums of random variables in the domain of attraction of the normal law Qunying Wu1,2 College of Science, Guilin...

Ngày tải lên: 20/06/2014, 21:20

13 482 0
Báo cáo hóa học: " Some nonlinear delay integral inequalities on time scales arising in the theory of dynamics equations" ppt

Báo cáo hóa học: " Some nonlinear delay integral inequalities on time scales arising in the theory of dynamics equations" ppt

... arising in the theory of differential equations J Math Anal Appl 251, 736–751 (2000) doi:10.1006/jmaa.2000.7044 19 Sun, YG: On retarded integral inequalities and their applications J Math Anal ... is, for a ≥ 0, b ≥ we always have ω (a + b) ≤ ω (a) + ω (b) and ω(ab) ≤ ω (a) ω(b) τ, a, j are the same as in Theorem 2.1 If u(t) satisfies the inequality (1) with the initial condition (2), then for ... t0 A suitable application of Theorem 2.1 to (73) yields the desired inequality Remark 3.1: In the proof for Theorem 3.1, if we apply Theorem 2.2 instead of Theorem 2.1 to (73), then we obtain another...

Ngày tải lên: 21/06/2014, 01:20

14 420 0
w