the a food b food lecture

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces signiﬁcant structural changes doc

... form a distorted chair The C-terminal a- domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and human are available ... synthesis was from Rapp Polymere (Tubingen, Germany), and all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a- and b- domains The individual a- and b- domains ... b- Domain Proton Asn (a) Asn (a) Asn (b) Cys (a) Cys (b) Asn 23 (b) a- Domain Lys (NH) Lys (a) Ser (b) Ser (HN) Cys (HN) Cys (a) Cys (b) Ser (b) Cys (a) Cys (a) Cys (a) Cys (b) Cys (b) Cys (a) Cys...

Ngày tải lên: 07/03/2014, 09:20

14 486 0

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen afﬁnities of the a and b subunits potx

... afﬁnity, K, can be derived for both the a and b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association and dissociation rate constants for the b subunits are found ... ! ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À a; bO2 ÞðaO2 ; bO2 Þ þ O2 ka À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! hv ð1Þ ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À ðaO2 ; b ðaO2 ; bO2 Þ þ O2 ! kb À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! where (aO2, ... ligands leaves the a subunits (Table 1, ), and in every six ligands leaves the b subunits (Table 1, ) Using Eqns (3) and (4), the dissociation rate constant, k, and the O2 afﬁnity, K, can...

Ngày tải lên: 16/03/2014, 14:20

11 578 0

The a and b adapters are used as priming sites for both amplification

... filters all DNA rich beads from empty beads, and then extracts the biotin beads from the DNA rich beads • The DNA in the beads are denatured again using sodium hydroxide, creating ssDNA rich beads ... since their composition is known • The B adapter contains a 5’ biotin tag used for mobilization • The beads are magnetized and attract the biotin in the B adaptors Filtering the Mess • There are ... Preparation of the DNA • DNA is fragmented by nebulization • The DNA strand’s ends are made blunt with appropriate enzymes • A and B adapters are ligated to the blunt ends using DNA ligase...

Ngày tải lên: 19/03/2014, 22:32

19 392 0

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

... primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse primer CA GTAGCTTCATCTTTCGATCGACTTCTTCCATGCGA GA) The second PCR used a universal pair of primers [34,48] PJ69- 4a [48] was then transformed ... signal-regulated kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp9 0b, as well as the native yeast Hsp90s, were all capable of activating GR in these ... Hsp90s but 5¢ homologies to plasmid pBDC [34] (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer...

Ngày tải lên: 23/03/2014, 07:20

11 428 0

Báo cáo Y học: Substrate selectivity and sensitivity to inhibition by FK506 and cyclosporin A of calcineurin heterodimers composed of the a or b catalytic subunit potx

... recombinant CnAa and CnAb baculoviruses (Fig 1B, C) Kinetic assays of CaNa and CaNb phosphatase activity Fig SDS/PAGE and Western blot analysis of baculovirus expressed CaN composed of CnAa or CnAb ... by plaque assay as described [10] The coinfection, expression and puriﬁcation of baculovirus-expressed CaN containing the rat brain CnAa subunit and rat brain CnB, or the human CnAb subunit and ... is a more potent inhibitor of both CaNa and CaNb than CyPA/CsA Activation of CaNa and CaNb phosphatase activity by FKBP12/FK506 toward pNPP In contrast to the inhibition of CaN phosphatase activity...

Ngày tải lên: 24/03/2014, 03:21

9 474 0

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

... phylogenetic analysis Enzyme Species GenBank/EBI A transferase A transferase A transferase A (cis A/ B) transferase A- likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase ... intron boundaries were obtained by analysis of the rat genomic sequences available in the NCBI database The programs used are all available from http://www.infobiogen.fr Chromosome localization The ... Ó FEBS 2002 kidney, the urinary bladder, the uterus and the thymus A weaker signal was obtained from the pancreas and very weak, barely detectable, signals were visible from a salivary gland,...

Ngày tải lên: 31/03/2014, 09:20

8 500 0

Minimum Wages and Employment: A Case Study of the Fast-Food Industry in New Jersey and Pennsylvania pot

... October 1989 Bureau of National Affairs Daily Labor Report Washington, DC: Bureau of National Affairs, May 1990 Labor Relations Reporter Wages and Hours Manual Washington, DC: Bureau of National ... gives an estimate of the "reliability ratio" (the ratio of the variance of the signal to the combined variance of the signal and noise) The estimated reliability ratios are fairly high, ranging ... employment before, all available observations FTE employment after, all available observations Change in mean FTE employment Change in mean FTE employment, balanced sample of storesC Change in mean FTE...

Ngày tải lên: 08/03/2014, 06:20

26 870 0

Dự án nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed (Milestone 7) " potx

... a SME in the animal feed sector and the research team members from CAP/IPSARD and UWA The list of delegates is attached as Appendix I Mr.Teerasant Sirichayaporn, Executive chairman of the Thai ... cleaning using STATA In October, Dr Brennan and Ms Marsh designed templates for the CAP team to provide guidance and direction for the preliminary analysis of the data Dr Brennan and Ms Marsh then ... analysis stages 7.3 Sustainability The location of Dr Brennan in CAP has contributed to the sustainability of the skills and knowledge being applied by the project team in this project, by enabling...

Ngày tải lên: 21/06/2014, 04:20

12 529 0

Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed " docx

... in capacity as assessed against benchmark indicators by end of project Capacity assessment is possible Training and research will build capacity in needed areas Australian team members have adequate ... carried out by the GSO Indicators available are: • Total capital • Total labor • Total asset • Business performance • Income of labors ACTIVITY 3.1.2 - Number of It has become apparent that available ... addressing budget issues identified by the CARD PMU, and hence there was a delay in signing the Contract between UWA and Hassall & Assoc This resulted in a delay in establishing the budget line at UWA...

Ngày tải lên: 21/06/2014, 04:20

19 499 1

Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed - Milestone 4 " ppt

... can’t buy raw materials to store for months, have no advanced technology, and have to employ too much labour • Small companies say that their biggest issues are availability of capital and land, ... smaller agents operating in remote areas This avoids payment risk with farmers as the agents pay the company directly • Large companies say that small companies can’t compete: they have no capital, ... company • The importance of storage capacity and its impact on buying and importing strategies Can the GoV play a role in providing storage capacity for SMEs? • Varying quality control capability...

Ngày tải lên: 21/06/2014, 04:20

5 535 0

Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed - Use of Industrial and Mixed Feed by Livestock Producers in Vietnam " doc

... of Melamine in animal husbandry and aquaculture The decision prohibits the import, production and use of materials and animal feed contaminated with melamine The acceptable level of melamine ... stages For broilers, stage lasts on average for about 29 days, stage is the next 48 days and stage is the last 40 days For layers, the respective length of the stages is 94 days, 172 days and ... have valuable input into policy for that sector The Thai Feed Mill Association was also mentioned as an enterprise association that had policy input in Thailand A further idea was that the Government...

Ngày tải lên: 21/06/2014, 05:20

27 538 0

Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed " pdf

... members, other dairy cooperatives in the area, a number of large farms owned by the military, a government farm and one private farm They are looking to expand their market to agents in Chang Mai ... applying to the Government each year for the amount of soybean meal imports that can be made at the “quota” tax rate (4%) The “official” quota is too small, and the over-quota rate is officially ... 2000, a program entitled Agricultural Production Quality Standard and Management Improvement was financed by the ADB Agriculture Sector Program Loan (ASPL) enabling a number of agro-industrial plant...

Ngày tải lên: 21/06/2014, 05:20

14 585 0

Báo cáo nghiên cứu nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed " pptx

... should be expanded  Support and expand the role of the Vietnamese Animal Feed Association (VAFA)  Investigate the possible ways the government may provide price support for raw materials and livestock ... compared to around 11 labor units used by both medium and large firms, and this difference was significant This may indicate under-utilization of labor by small firms, or capital substitution by ... regions: Ha Noi, Ha Tay and Hung Yen provinces located in the Red River Delta; Binh Duong and Dong Nai in the South East; and Tien Giang and Long An in the Mekong River Delta The mills have been categorized...

Ngày tải lên: 22/06/2014, 13:20

6 467 0

Báo cáo y học: "Phytalgic®, a food supplement, vs placebo in patients with osteoarthritis of the knee or hip: a randomised double-blind placebo-controlled clinical trial" potx

... and/or hip, which is an advantage and a drawback: an advantage because it can be seen as a real-life population, increasing generalisability of the results, a drawback because the patients were heterogeneous ... available data at each time point and baseline observation carried forward (BOCF) approach for missing data at M1, M2 and M3 Quantitative variables were described in terms of mean ± SD, median ... year-old patient was above the age range There was no difference between the active and placebo groups for initial distribution of any of the studied parameters (Table 1) Use of analgesics and...

Ngày tải lên: 12/08/2014, 11:22

9 442 0

Tài liệu The Slow Food Story ppt

... Wallace, Cinzia Scafﬁdi, Giulio Colomba, Anya Fernald (and later after she moved back to San Francisco), Silvia Monasterolo, Alessandro Monchiero, Alberto Farinasso, Sibilla Gelpke and Elena Aniere ... asserted by him in accordance with the Copyright, Designs and Patents Act 1988 British Library Cataloguing in Publication Data A catalogue record for this book is available from the British Library ... supermarkets, by major changes in the way food is produced and consumed, and by the way animals are raised and local traditions are eroded In the US, fast food became central in this way of life:...

Ngày tải lên: 25/01/2014, 19:20

211 703 0

Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

... in the metal-dependent nonoxidative decarboxylation catalysed by a- amino -b- carboxymuconate-e-semialdehyde decarboxylase J Am Chem Soc 129, 9278–9279 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe ... decarboxylase (ACMSD) J Biol Chem 277, 35162–35167 Tanabe A, Egashira Y, Fukuoka SI, Shibata K & Sanada H (2002) Expression of rat hepatic 2-amino3-carboxymuconate-6-semialdehyde decarboxylase ... Immunopathogenesis of cerebral malaria Int J Parasitol 36, 569–582 Medana IM, Day NPJ, Salahifar-Sabet H, Stocker R, Smythe G, Bwanaisa L, Njobvu A, Kayira K, Turner GDH, Taylor TT et al (2003) Metabolites...

Ngày tải lên: 18/02/2014, 06:20

9 797 0

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... FEBS G Vaaje-Kolstad et al Degradation of a- and b- chitin The degradation rates of a- and b- chitin were assayed with LlChi1 8A in the presence or absence of LlCBP3 3A As both chitin variants, and ... lactic acid bacterium (LAB) Lactococcus lactis ssp lactis IL1403 LABs are Gram-positive, facultatively, anaerobic, fermentative bacteria that are of major importance in the food industry for the ... with a rapid phase, regardless of the presence of LlCBP3 3A In the presence of LlCBP3 3A, the fast initial phase was maintained longer than in the absence of LlCBP3 3A, indicating that LlCBP3 3A acts...

Ngày tải lên: 18/02/2014, 08:20

14 684 0