tangent plane to a surface ppt

... molecules and peptide atoms) and rj is the standard deviation of B factors The normalized B factors have a zero mean and unit variance All atoms that satisfy Bz ‡ are treated as outliers and discarded ... cargo The average atomic B factors for importin-a in the structure are ˚ ˚ 32.1 A2 for main-chain atoms, 35.7 A2 for side-chain ˚ overall (3244 atoms) For the pepatoms and 33.8 A tide, B factors ... provided that CLIC4 can undergo a conformational rearrangement that exposes the NLS in an extended conformation Database Structural data are available in the protein Data Bank under the accession

Ngày tải lên: 14/02/2014, 19:20

... requirement needs to account for the total wealth π t an investor may have Such totalwealth is defined as the total amount of cash (possibly negative) an investorwould own, after liquidating all his positions ... two tradable assets, BF is tradable. Trang 9In this example, the investor having engaged in a strategy θ relative to X and ψ relative to B, will experience a change in wealth dπ tover a small periodof ... a stochastic process, and t a particular point in time, the various realizations that X can have at time t is also a random variable, denoted X t Needless to say that the notation X t can be

Ngày tải lên: 16/02/2014, 03:20

... Sequence Forward ompA* 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG Reverse ompA105 5¢-GCCATGAATATCTCCAACGAG Reverse ompA117 5¢-CATCCAAAATACGCCATGAATATC Forward 5¢rpsO 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG Reverse ... 5¢-GCTTCAGTACTTAGAGAC Forward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC Reverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGG Reverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGG Forward rpsO internal 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG Reverse ... 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG Reverse 3¢rpsO-(C)18 5¢-C(18)GAAAAAAGGGGCCACTCAGG Reverse 3¢rpsO-(G)18 5¢-G(18)GAAAAAAGGGGCCACTCAGG Reverse 3¢rpsO-(N)18 5¢-GAATTGCTGCCGTCAGCTTGA Forward oxyS109*

Ngày tải lên: 19/02/2014, 16:20

... Trang 1CHAPTER 2B PROGRAMMIG TIP After the first laboratory assignment several students came to my office and asked questions that were very similar Thus, this addendum to Chapter 1 was ... all the functions and variables needed to write the program Make a structure chart and show the data flow Next, write the psuedocode for each of the modules A structure chart tells you what to ... what to do, a psuedocode tells you how to do it I will cover this in class at great detail Trang 2Here is an example of a programming assignment Write a program to determine how many quarter rolls,

Ngày tải lên: 20/02/2014, 08:20

... contains a sequence of passwords that matches a sequence stored in a database for that user account and the online service (see two-factor authentication) PaaS See Platform as a Service Patriot Act ... Google App Engine and other PaaS systems machine image See virtual appliance mashup A web page or web application that combines data and/or functionality from multiple sources to create a new ... British Library Cataloguing-in-Publication Data A CIP record for this book is available from the British Library Library of Congress Cataloging-in-Publication Data Williams, Mark I   A quick start guide

Ngày tải lên: 05/03/2014, 17:20

... http://www.angelfire.com/ca6/aryanorder/aryanyouth/ Atlanta Aryan Nations http://www.atlantaaryannations.zoomshare.com/ Australian HammerSkins http://www.hammerskins.com/schs/ Trang 20Name URL Comments ... Klan St Clairsville, OH Aryan Nations Knights Realm of Pennsylvania http://aryannationsknights.com/PENNSYLVANIA.htm http://www.aryannationsknights.com/Realm%20of%20PA.htm Adamstown, PA Aryan Nations ... Northeast http://www.aryan-nations.org/newyork/ The Aryan Nations Organization http://www.aryannationsrevival.org/ Aryan Nations of Pennsylvania http://www.aryan-nations.org/pa/ Trang 17Name URL

Ngày tải lên: 06/03/2014, 21:20

... such as social media and mobile into the marketing mix to attract and engage consumers However, they are not ready to abandon traditional approaches to consumer marketing CG marketers say they want ... engagement and loyalty through social media can have a direct impact on sales P&G’s Secret deodorant brand, for example, has fostered a Facebook community with more than 1.3m fans More than ... existing handsets—in 2012 Diageo is another CG manufacturer that has also turned to social media—Facebook specifi cally—to enhance its consumer marketing efforts and drive retail beverage sales The

Ngày tải lên: 07/03/2014, 10:20

... eight to ten words and limit paragraphs to three to five sentences Communicate as if you were talking to a friend A conversational style has a more natural tone and is easy to friend Say: You ... may not be as clear with Image A Image B Image A Trang 16For a sense of scale, draw small objects larger to show detail Also show something familiar to give your audience a sense of scale ... This paragraph is hard to read because the lines are too long After reading one line, your eyes have to move back across the entire page to find the start of the next line Paragraphs that run across

Ngày tải lên: 14/03/2014, 20:20

... 5¢-AAACCAGCCATGAATGAAAT-3¢) and with actin primers (forward primer: 5¢-GTTGGGAT GAACCAGAAGGA-3¢; reverse primer: 5¢-GAACCA CCGATCCAGACACT-3¢) as a control Reactions with no DNA added served as a ... promoter frag-ment The sequences of the oligonucleotides used for these experiments are: Oligo I, 5¢-CAAGGACGTTCGATGCA CTTCCAAAAAACATATAAT-3¢; Oligo II, 5¢-CAAT GTAGTATTAAAAAGTAGTAGTTAAAAGC-3¢; ... regulator of the CaM5 gene promoter that may act in a similar way to the DREAM protein, a negative transcrip-tional regulator that acts in a calcium-dependent manner [63] During normal growth and

Ngày tải lên: 18/03/2014, 01:20

... 12,$+*3++45-+$,66*#67++ A part-of-speech tag set is a classification system that allows you to sign some grammatical description to each word occurrence in a text This assignment can be done by hand or automatically ... social stratification you want to be in a position where the surface form of any word occurrence can be mapped to a more abstract rep-resentation that allows algorithms to identify features one surface ... since the apostrophized ‘s’ can also stand for ‘is’ or ‘has’ in contracted forms, where it has a linguistically sounder claim to be treated as a separate word But if you want a tag set ca-pable of

Ngày tải lên: 24/03/2014, 19:20

... continue to learn and advance from the input they get from mentors In fact, 95% of respondents said having a mentor is important to advancing your education as a professional animator They also state ... looked at what was most important to potential students about their education by country, Australia, Canada, Germany, the U.S and the UK chose quality of curriculum as their top picks Canada also ... animation education program placed more emphasis on the ability to learn remotely at 38%, and the quality of student work at 31%, than learning from professional animators at 15% Canadians also

Ngày tải lên: 31/03/2014, 15:20

... language (Such languages became fairly standard largely due to Montague's work.) Montague always claimed that this was merely a pedagogical and simplifying device; and he provides an abstract account ... may learn not just that Melanie saw a bear, but also that the speaker is somehow connected to Melanie in away that allows him to refer to her using "Melanie", And I learn that the speaker ... Trang 1A PROLEGOMENON TO SITUATION SEMANTICS David J Israel Bolt Beranek and Newman Inc Cambridge, MA 02238 ABSTRACT An attempt is made to prepare Computational Linguistics for Situation Semantics

Ngày tải lên: 31/03/2014, 17:20

... preclinical studies to ensure safety Akio Ido1,2*, Akihiro Moriuchi1,2, Masatsugu Numata1,2, Toshinori Murayama3, Satoshi Teramukai4, Hiroyuki Marusawa5, Naohisa Yamaji1,2, Hitoshi Setoyama1,2, ... and male Wistar rats, seven weeks of age, were obtained from Japan Farm (Kagoshima, Japan) and Charles River Laboratories Japan Inc (Yokohama, Japan), respectively The animals were maintained ... Ltd., Tokushima, Japan) [22] Laboratory data, including PT-international normalized ratio (PT-INR), T-Bil, serum albumin, ala-nine aminotransferase (ALT), anda-fetoprotein (AFP), were examined

Ngày tải lên: 18/06/2014, 19:20

... Kine-matic data was sampled at 120 Hz All other signals were sampled at 1200 Hz Three-dimensional kinematic data was recorded using a 6-camera video system (Motion Analysis Corporation, Santa Rosa, ... Active Ankle Angle (degrees) Trang 6The band of steady state variation for each outcomeparameter was calculated as the mean ± two standard deviations from the steady state period Time to steady ... steady state range afterwards This analysis was per-formed for each subject individually Differences in learn-ing rate (time to steady state) were assessed uslearn-ing a repeated measures ANOVA

Ngày tải lên: 19/06/2014, 10:20

... other hand, we know that delay arises naturally in practical systems due to the transmission of signal or the mechanical transmission Though theory of ordinary differential equations with delays ... However, not much has been done for fractional differential equations with delays Therefore, in this paper, we consider a boundary value problem of a general delayed nonlinear fractional system With ... differential equations have been extensively studied, most of the studies focus on scalar equations and the fractional order between 1 and 2 On the other hand, delay is natural in practical systems

Ngày tải lên: 21/06/2014, 05:20

... Similarly, a family of Hadamard-like trans-forms and a family of slant-like transtrans-forms have been intro-duced in [22,23] The general goal of this paper is to analyze the potential advantages ... algorithm of the same structure In particular, a family of Haar-like transforms that can all be computed with fast algorithm in structure simi-lar to classical fast Haar transform algorithm has been pro-posed ... Trang 1Volume 2007, Article ID 58416, 14 pagesdoi:10.1155/2007/58416 Research Article On a Class of Parametric Transforms and Its Application to Image Compression Susanna Minasyan, 1 Jaakko Astola,

Ngày tải lên: 22/06/2014, 20:20

... Trang 52 Some basic properties of Karamata regular variation theoryLet us continue to recall some basic properties of Karamata regular variation theory (see [13]) Lemma 2.1 If L is slowly varying ... [11] A C Lazer and P J McKenna, On a singular nonlinear elliptic boundary-value problem, Proceed-ings of the American Mathematical Society 111 (1991), no 3, 721–730. [12] A Nachman and A Callegari, ... Aranda and Godoy [1] showed that problem (1.1) has a unique solutionu ∈ Wloc2,p(Ω)∩ C(Ω) Most recently, applying Karamata regular variation theory, Cˆırstea and R˘adulescu [3] and Cˆırstea and

Ngày tải lên: 22/06/2014, 22:20

... thatU + C has a fixed point. For anya ∈ X, define the operator U a:X → X by U a(x) = U(x) + a It is easy to see that U ais ak-contraction mapping and so for each a ∈ X, U aadmits a unique fixed ... be a Fr´echet space and let C, D : X → X be two ators. oper-Suppose that the following hypotheses are fulfilled: (a)C is a compact operator; (b)D is a contraction operator with respect to a family ... 4.1 A function x is said to be an asymptotically stable solution of (1.2) if forany solutionx of ( 1.2), lim Trang 11In this section, we assume that (A1)–(A4) hold and assume in addition that(A5)V

Ngày tải lên: 22/06/2014, 22:20

... Multimedia Distribution on Radio Channel and Asymmetric Channel 3 Danilo Merlanti and Gianluca Mazzini Part 2 Multimedia and Wireless Networks 27 Chapter 2 A Dynamic Link Adaptation for Multimedia ... Codes Against Averaging Attack for Multimedia Fingerprinting 125 Hideki Yagi and Tsutomu Kawabata Chapter 7 Evaluation of Multimedia Fingerprinting Image 141 Kang Hyeon RHEE Trang 6Part 4 ... Learning with LDA Topic Models for Visual Concept Detection 175 Sheng Tang, Yan-Tao Zheng, Gang Cao, Yong-Dong Zhang and Jin-Tao Li Part 5 Managing Multimedia Content and Metadata 201 Chapter

Ngày tải lên: 27/06/2014, 05:20

... QubitsNTT Basic Research Laboratories, Atsugi-shi, Kanagawa 243-0129, Japan The spin of an electron placed in a magnetic field provides a natural describe the experimental steps we have taken towards ... contain at least partly original and previously unpublished material, be written in a clear, pedagogical style and aimed at a broader readership, especially graduate studentsand nonspecialist ... ofappropriate variables as a result of averaging over “unimportant” variables ispresented This is then aptly applied to large quantum dots The all impor-tant scales, ballistic dots and chaotic motion are

Ngày tải lên: 27/06/2014, 10:20