... presentation to the ED ≤4h > but ≤ 12 h 60.0 (17. 0-92.7) 14.2 (0 .3- 32.2) 42.8 (18.8-70 .3) 33 .3 (17. 2-61 .3) Table Diagnostic indices of Cardio Detect and TnT Parameter Cardio Detect (95% CI) TnT ... 0.769 0. 031 0.608-0. 930 > 12 but ≤ 24 h (group 3) CardioD 0.611 0.505 0 .30 8-0.914 TropT 1.000 0.0 03 1.000-1.000 Combine CardioD & TropT 0.611 0.505 0 .30 8-0.914 CardioD 0 .33 3 0.655 -0.2 83 to 0.949 ... Hypertension 43 10 33 Hyperlipidemia 26 20 Smoking 38 13 25 Previous history of CVD 44 35 Serum creatinine (μmol/l ± SD) 115. 1 ± 28.5 117. 0 ± 27.4 114.4 ± 29.1 Family history of heart disease 22 17 the...
Ngày tải lên: 20/06/2014, 23:20
... ( 130 0 170 0) (1600–2000) 30 00a 170 0b
Ngày tải lên: 09/08/2014, 06:22
INVESTIGATION ON CLINICAL FEATURES, BRAIN IMAGING, a NUMBER OF RIKS FACTORS AND THE VALUE OF d DIMER IN DIAGNOSIS OF CEREBRAL VENOUS THROMBOSIS
... of patients 58 34 30 22 19 18 5 3 Percent (%) 98 .31 57. 63 50.85 37 .29 32 .2 30 .5 8.47 8.47 5.08 5.08 3. 3 IMAGING CHARACTERISTICS 3. 3.2 Location of cerebral venous thrombosis Table 3. 16: Characteristics ... 1890.92 30 9. 03 146 .19 15.55 58 57 investigated patients KTC 95% 1272.5 - 2509 115. 03 - 177 .35 Non-uniform variance T-test t = -5. 63; p = 0.000 3. 5 .3 Identify the cut off of D-dimer test Table 3. 31: ... ≥256 93. 1 80.7 83. 08 92 0.869 ≥280 93. 1 30 2 91 .33 ≥424 79 .3 ≥502 74.1 ≥604 62.07 82.46 89.47 98.25 84 .38 89. 83 97.87 92.16 91.07 82 .35 0.877 0.90 0.887 98.25 97. 73 78.87 0.861 98.25 97 .3 71.79...
Ngày tải lên: 21/10/2014, 21:52
Tài liệu Báo cáo khoa học: The role of the SEA (sea urchin sperm protein, enterokinase and agrin) module in cleavage of membrane-tethered mucins pdf
... 5¢-GGACTAGTAGATGTAGTGGAGACCGAG -3 (AF1 433 71 180 198 ), 3- SEA-R (antisense) 5¢-CCGCTC GAGTCAGGCTTAAAACACAGG -3 (AF1 433 71 5 13 530 ), 12-SEA-F 5¢-GGACTAGTGGAAAAACTCAAGGCCACT TTAGG -3 (AF147790 818–841) and 12-SEA-R ... pair used to produce the MUC3 cDNA insert was (sense) 5¢-ATTTATAAGGGCTTCACC TTCAAG -3 (AF1 433 71 32 4 33 9) and (antisense) 5¢-CTCC ACGTCGTGCTGGGGGCTGAAGGG -3 (AF1 433 71 406– 420), the MUC12 cDNA ... -VIVNSKMKFAKSVPY QNLEILFRNGS¼¼¼IVVNSRMKFANSVPP J05582 U1 6175 L415 43 U36918 L41546 AF1 433 71 U76551 AF147790 AF361486 [12] AF 430 017 AB 0191 20 AF 0177 76 AF157624 surface membrane [4] MUC1 subunits remain...
Ngày tải lên: 19/02/2014, 18:20
Child-friendly health care: the views and experiences of children and young people in Council of Europe member States doc
... their age and circumstances Age The majority of children who completed the survey (40.1%) were aged between 13 and 15 years A further large proportion was between 16 and 18 years (33 .1%) and smaller ... Bosnia and Herzegovina, Bulgaria, Estonia, Finland, France, Georgia, Germany, Greece, Ireland, Italy, Malta, Netherlands, Poland, Portugal, Romania, Serbia, Slovakia, Slovenia, Spain and the ... logistical and methodological – and it is important that the Council of Europe and other organisations continue to learn from, and improve, their work in this field How the bodies who ask children and...
Ngày tải lên: 17/03/2014, 17:20
SPECIFICITY OF SPUTUM SMEAR COMPARED TO CULTURE IN DIAGNOSIS OF PULMONARY TUBERCULOSIS docx
Ngày tải lên: 22/03/2014, 18:20
Báo cáo khoa học: Mechanism for transcriptional synergy between interferon regulatory factor (IRF)-3 and IRF-7 in activation of the interferon-b gene promoter docx
... CBP–C2(2 036 –2 231 ); CBP– C3(2 231 –2441); CBP–C(1892–2441); p300–N(1–596); p300–M(744–1571); p300–C1(1855–2010); p300–C2(2010–2210); p300–C3(2210–2414); and p300–C(1571– 237 0) The intensity of binding, expressed ... 8.2 56 .3 IRF-7WT 2.9 2.7 28.8 34 .6 IRF-3E7 1.0 0.9 1.8 2.6 IRF-3WT Fold induction P 431 ·3CAT Vector IRF-3E7 IRF-7DI IRF-3E7/ IRF-7DI Synergy vs additive P 431 ·3CAT Vector IRF-3E7 IRF-7DI IRF-3E7/IRF-7DI ... SV 0.04 5.79 0. 03 13. 1 0.05 6 .17 20.0 32 .7 Fig IRF -3/ IRF-7 maximally activates both PRD III and PRD I (A) Sequence of PRD III, PRD I and optimal binding sites for IRF-1, IRF -3 and IRF-7 [47,48]...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Subcellular localization of yeast Sec14 homologues and their involvement in regulation of phospholipid turnover pptx
... sec14–1ts ura3, lys2, his3, cki1::HIS3 ura3, lys2, his3, sec14–1ts, cki1::HIS3 ura3, lys2, his3, sec14–1ts, cki1::HIS3, [YEp195-SFH2] ura3, lys2, his3, sec14–1ts, cki1::HIS3, [YEp195-SFH4] ura3, lys2, ... sfh5::SFH5-yEGFP ura3, leu2, his3, trp1, sfh3::hisG ura3, leu2, his3, trp1, sfh4:: HIS3 ura3, leu2, his3, trp1, sfh3::hisG sfh4::HIS3 ura3, leu2, his3, trp1, sfh1::kanMX4 ura3, leu2, his3, lys2, sfh5::kanMX4 ... his3, sec14–1ts, cki1::HIS3, pld1::kanMX4, [YEp195-SFH4] his3, leu2, trp1, ura3 leu2, his3, ura3, pct1::URA3, sec14::kanMX ade, trp1, his3, ura3, leu2, cki1::HIS3, sec14::kanMX leu2, his3, ura3,...
Ngày tải lên: 23/03/2014, 18:20
báo cáo hóa học:" Sigma-2 receptor ligands potentiate conventional chemotherapies and improve survival in models of pancreatic adenocarcinoma" ppt
... split and preincubated for more than 24 hours (Panc-02) and 48 hours (CFPAC-1, AsPC-1, and Panc-1) to maintain their growth conditions SV 119 and SW120 were dissolved in DMSO, and gemcitabine and ... SV 119 (Figure 3) Combining SV 119 with a chemotherapy increased apoptosis Mean TUNEL-positivity ranged from 26.5% to 70.5% in the SV 119 and gemcitabine combination (50 nM) and from 26.6% to 53. 8% ... the specificity of SW120 for Sigma-2 receptor binding, 10μM of SV95 (Sigma-2 ligand) or (+)-pentazocine (sigma-1 receptor ligand) were added to cells 30 minutes prior to SW120 treatment All lines...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học: " Proinflammatory and proapoptotic markers in relation to mono and di-cations in plasma of autistic patients from Saudi Arabia" docx
... (mmol/L) 158.28 1 23. 40 ± 23. 37 225.42 34 7.41 2 73. 95 ± 30 .82 Control 30 6. 53 395.66 36 0.85 ± 29.05 129.44 38 1.28 2 53. 16 ± 64.07 Control 9.49 14.77 12.29 ± 1. 53 Autistic Mg2+ (mmol/L) 3. 17 6.85 4.42 ... Neuropharmacology 199 6, 35 :17 43- 175 2 33 Chidekel AS, Friedman JE, Haddad GG: Anoxia-induced neuronal injury: role of Na+ entry and Na+-dependent transport Exp Neurol 199 7, 146:4 03- 4 13 34 Stys PK, Lopachin ... (ethylenedinitrilo)tetraacetate Anal Chem 196 0, 32 :11 23 42 Klein B, Oklander M: Clin Chem 197 6, 13: 26 43 Rees S, Harding R, Walker D: The biological basis of injury and neuroprotection in the fetal and...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học:" The role of FGF-2 and BMP-2 in regulation of gene induction, cell proliferation and mineralization" pptx
... 85,081. 73 2, 531 6 .39 **678.21 35 8.27 *170 ,2 43. 43 24,4 93. 77 0.00 03 Fibronectin 55,827. 93 1,2 119. 18 *28, 432 .19 1195 .92 ** 239 ,750.67 23, 464 .19 0.0001 3, 249.41 689.70 **50.65 13. 30 4,1 93. 34 739 .19 0.0006 ... RUNX2 34 9.09 40. 63 **674.95 63. 04 1,0 43. 65 7 83. 29 n.s VEGFA 109. 49 38 .86 **5, 132 .66 755.22 537 . 13 379.66 0.0007 IGF1 TGFb 93. 08 10.55 **245.40 41. 93 *185.20 38 .34 n.s ALP OC 58 .30 16.20 34 .81 3. 19 ... 13. 39 **1 .38 11.68 0.65 91.77 *34 .04 23. 15 6.11 0.0064 0.0008 Noggin 7.11 2.77 *1.61 0.49 2.41 1.76 n.s BMP-2 0.40 0.12 **0.06 0.01 0 .38 0.05 0.0004 MMP3 0. 03 0. 03 **4.04 0.97 0.12 0.14 0.0023...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Accuracy of 64-multidetector computed tomography in diagnosis of adnexal tumors" ppt
... compared to: PPV NPV Accuracy 95.4% 89.4% 91 .3% 90.7% 72.2% 93. 4% 84.2% 87.75 90.7% Surgery 81.2% 100% 100% 94.2% 95 .35 83. 3% 94 .3% 76.9% 96.1% 92 .3% Surgery 79.1% 95.1% 90.45 88.65 89.2% Histopathology ... masses Curr Opin Urol 2007, 17 :32 -38 Forstner R, Hricak H, Occhipinti KA, Powell CB, Frankel SD, Stern JL: Ovarian cancer: staging with CT and MR imaging Radiology 199 5, 197 : 619- 626 10 Tempany CM, ... patients were overstaged and seven understaged However, there were significant agreements between MDCT and surgical findings ( = 0.891) and between MDCT and histopathologic findings ( = 0.858) Figure...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo hóa học: " A survey of classical methods and new trends in pansharpening of multispectral images" docx
... Photogramm Eng Remote Sens 51 (3) , 31 1 31 6 (198 5) 29 R Welch, M Ehlers, Merging multiresolution SPOT HRV and landsat TM data Photogramm Eng Remote Sens 53( 3), 30 1 30 3 (198 7) 30 R Haydn, GW Dalke, J ... Photogramm Eng Remote Sens 55 (3) , 33 9 34 8 (198 9) 34 P Chavez, S Sides, J Anderson, Comparison of three different methods to merge multiresolution and multispectral data: Landsat TM and SPOT panchromatic ... On Pattern Analysis And Machine Intelligence 11(7), 674–6 93 (198 9) doi:10. 1109 /34 .192 4 63 42 J Zhou, DL Civco, JA Silander, A wavelet transform method to merge Landsat TM and SPOT panchromatic...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo lâm nghiệp: "Moisture effect on carbon and nitrogen mineralization in topsoil of Changbai Mountain, Northeast China" pptx
... coniferSilt 1,600 Andosols ous forest loam 800 2 .32 7 03. 62 11.5 68 .17 1.27 60.60 6.70 8.79 1.25 0.075 –1.78 933 .67 16.7 34 .87 1.18 60 .30 5.80 8.50 0. 93 0.0 63 1,800 Erman’s birch Sandy Andosols forest ... 1002.09 15.5 32 .70 1.05 122.9 4.90 10.50 3. 00 0.057 2,000 Alpine tundra 3. 82 1075. 53 15.9 12.21 1.06 114.62 4.96 10.00 2.80 0. 038 Andosols Sandy loam J FOR SCI., 57, 2011 (8): 34 0 34 8 34 1 Soil incubation ... 15.29Aa* 0.052 ± 0.009a* 16.51 ± 3. 45Aa* Ba 961.40 ± 16.97 * Ca 1 ,37 7 .17 ± 49 .39 * Ab 39 6.88 ± 20.57 * Bb 729. 73 ± 60 .35 * Cb a 0.071 ± 0.005 * a 0.0 63 ± 0.002 * Ba 68.55 ± 3. 66 * Ca 89.98 ± 10.01 *...
Ngày tải lên: 07/08/2014, 10:21
Báo cáo lâm nghiệp: "Infra-red images of heat field around a linear heater and sap flow in stems of lime trees under natural and experimental conditions" doc
... Heating, Piping, and Air Conditioning 13 (194 1) 38 0 39 1 [14] Marshall D.C., Measurements of sap flow in conifers by heat transport, Plant Physiol 33 (195 8) 38 5 39 6 [15] Nadezhdina N., Temperature ... xylem layers of the whole stem) again due to limited stem water storage 3. 3.2 Tilia_1 3. 3 Cutting experiments 3. 3.1 Tilia_2 3. 3.1.1 Cutting above the sensor at 15.15 h (Fig 1, middle panel) Heat ... Botany 67 (1 936 ) 877–959 2 13 [10] Huber B., Schmidt E., Weitere thermoelektrische Untersuchungen uber den Transpirationsstrom der Baume, Tharandter Forstliche Jahrsblad 87 (1 936 ) 36 9–412 v [11]...
Ngày tải lên: 08/08/2014, 01:22
Báo cáo lâm nghiệp: "Starch and soluble carbohydrates in leaves of water-stressed oak saplings" ppsx
... 199 0; Fredeen et al, 199 1; Quick et al, 199 2; Wang and Stutte, 199 2; Rodrigues et al, 19 93) Decreased sucrose concentrations were also observed in apple trees or grapevine (Wang and Stutte, 199 2; ... al, 198 0) Large (Abrams, 199 0) including Q alba, Q macrocarpa and Q stellata (Parker and Pallardy, 198 8) A similar drift in osmotic potential has been postulated in Q petraea (Epron et al, 19 93) ... Physiol 60, 37 9 -38 3 Jones MM, Osmond CB, Turner NC (198 0) Accumulation of solutes in leaves of sorghum and sunflower in response to water deficits Aust J Plant Physiol7, 1 93- 205 Kaiser WM (198 7) Effects...
Ngày tải lên: 08/08/2014, 18:21
Báo cáo lâm nghiệp: " A flow cytometric evaluation of the nuclear DNA content and GC percent in genomes of European oak species" pptx
... pg (Band, 198 4 in Bennett and Smith, 199 1), 1.8 pg (Greilhuber, 198 8) or 1.58 pg (Ohri and Ahuja, 199 0), Q robur 2C= 1.59 pg (Ohri and Ahuja, 199 0), 1.61 pg (Ohri and Ahuja, Q rubra 2C 199 0) ... (Marie and Brown, 19 93) with 2.2 μL β-mercaptoethanol where R = Intensity Quercus / Intensity Petunia for Eb ethidium bromide and R Intensity Quercus / InHo tensity Petunia for Hoechst 33 342 ... Brown S, Kondorosi A (199 4) Genome size and base composition in Medicago sativa and M truncatula species Genome 37 , 264-270 Butorina AK (19 93) Cytogenetic study of diploid and spontaneous triploid...
Ngày tải lên: 08/08/2014, 18:21