table 6 16 aggregating results in a crosstab ta

... mạnh nhất đến sự hài lòng của sinh viên.A study conducted by Farrukh Kamran, Ayesha Afzal, and Dr Shahid Rafiq (2022) explores the satisfaction levels of students regarding the support services ... University of Punjab Measuring student satisfaction with services and facilities is a challenging task, prompting numerous researchers to investigate effective methods for assessment.Nghiên cứu ... satisfaction and loyalty It highlights that high service quality significantly enhances student satisfaction, which in turn fosters greater loyalty among students The research emphasizes the importance

Ngày tải lên: 13/01/2025, 13:59

... important intellectual content Authors BS and MH had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis All authors ... obesity as a risk factor for sleep disordered breathing in clinical samples [14] So far, insomnia (difficulty initiating and maintaining sleep) has received very little attention in relation to ... Directorate of Integration and Diversity (IMDi): [Education participation in high schools] 2014 Available at: http://www.imdi.no/no/Fakta-ogstatistikk/Fakta-og-statistikk/Utdanning/ Accessed March

Ngày tải lên: 02/03/2020, 15:16

... because of missing data (see Fig 1) Statistical methods The stanine-scores were calculated using the SAS statis-tical software package (Version 9, SAS Institute Inc., Cary, USA) To allow comparability ... IX220a] The funders had no influence on the data analysis and publica-tion of the results. Availability of data and materials The datasets generated and/or analyzed during the current study are ... served as the outcome variable Fig 1 Database Trang 6(Coding: 0 = no finding (Stanine score between 3 and 9),1 = reasonable findings or inconclusive finding (Stanine score of 1 or 2)) Separate multilevel

Ngày tải lên: 29/05/2020, 19:30

... lab) The size of the small labs might be related to comparative advantage E.g the price advantages of the small labs might be due to advantages of specialization Small labs generally offer a ... was the main reason for them not to participate in our survey Results and discussion Summary of data and analytic technique The data exploration has shown a considerable variability in the prices ... variability than analysing the original data with a number of average prices missing Due to the comparatively small sample size and to reasons of comparability we limited the following presentation and

Ngày tải lên: 23/03/2014, 05:22

... surgical Trang 5treatment group than in the pelvic floor training goup (seeTable 2, Table 3 and Figure 2) Adding menopausal status as a between-subject factor to the GLM also did not affect the results ... Social Embarrassmentand Total-Score (see Table 2, Table 3 and Figure 4) Adding menopausal status as a between-subject factor to the GLM did not affect the results for QOL (not shown) The intervention ... well-being) have usually been regarded as being only of sec-ondary importance The aim of this longitudinal study was to compare surgical treatment and pelvic floor training in patients with clini-cally

Ngày tải lên: 18/06/2014, 19:20

... women) At the beginning of the stationary treatment, a clinical diagnosis according to ICD 10 (International Classification of Diseases, 10th revision) was performed and a questionnaire was completed ... therapy [17] The stationary psychotherapeutic approach was holistic and included the concept of combining all areas of the clinic as the therapy location According to the background of a psychoanalytical ... situations Another objective of the individual therapy was to critically analyse the behaviour and activities at work to find a solution The main emphasis of this connection was to obtain information

Ngày tải lên: 20/06/2014, 00:20

... system In addition respondents are asked to value their own health state on a visual analogue scale (EQ-VAS) The EQ-VAS records a respondent’s self rated valuation of health status on a scale ranging ... individuals had missing values in the employment variable that were imputed taking into account the age, gender, marital status, years of education and income The rest of socio-demographic variables ... Netherlands Institute of Mental Health and Addiction; Spain: Ethical Committee of Sant Joan de Déu Serveis de Salut Mental, and Ethical Committee of Institut Municipal d’Investigació Mèdica) An informed

Ngày tải lên: 20/06/2014, 15:20

... Hypothesized associations Correlations with components Relative validity Variance explained Physical Mental Physical Mental Physical Mental Total Reliable Table 5 Mean SF-36 v.2 scale scores (standard ... analysis and drafted the first version of the manuscript CMT, ALN, LAA and MMV drafted the questionnaires and contributed in the analysis and interpretation of the data All authors read and approved ... population was divided into sets called domains, defined according to region and setting (urban or rural); 6 domains were established, and the study aimed to obtain indicators for each of them, as

Ngày tải lên: 20/06/2014, 15:20

... rating scale ranging from 0 (indicating no pain) to 10 (indicating pain as bad as you can imagine) Higher scores indicate greater pain sever-ity Based on previous analyses, scores of 0 to 3 are ... < 59 was classified as moderate, and 59 to 100 was classified as severe [20] Statistical significance was evaluated at the 0.05 level The data were held and analyzed by Covance Inc All analyses ... unpaid help from caregiver) Statistical Analysis Means, standard deviations (SD), medians, and ranges were calculated for continuous variables and frequency counts and percentages were calculated

Ngày tải lên: 20/06/2014, 15:20

... pre-ventive health care and clinical measure in a long and short version, and has been validated, applied and evalu-ated against physical risk factors prospectively in breast and colorectal cancer patients ... con-sent and took part in an initial evaluation in 2000/2001 (table 1) According to our institutional standard in 2000, we did not ask ethical approval in anonymous questionnaire based observational ... mistletoe baseline application rate and the small sample size (compare table 1) Colorectal cancer patients have in comparable stages with breast cancer patients an inferior survival which is banal news

Ngày tải lên: 20/06/2014, 15:20

... accounting principles (GAAP)and available for audit ✔ Tax returns—federal and state income taxes; property, sales, and payroll taxes Accounting and finance are not intuitive Many small businesseshire ... capture and record all thetransactions, operations, and activities that have financialconsequences for a business Accountants are also involved in otheractivities in finance that impact a business, ... expectations ✔ Management decision making—analyzing cash position to make decisions Chapter Trang 4✔ External financial reports—financial statements prepared ac-cording to generally accepted accounting

Ngày tải lên: 01/07/2014, 22:20

... to additional information appear in notes at the end of a topic Read the additional information in preparation for teaching the module During class, ensure that students are aware of the additional ... to Windows screen Describe the authentication process in a domain Explain what cached credentials are and how they are used In this practice, students will join a domain This practice takes approximately ... disc This practice takes approximately 15 minutes Lesson: Joining a Domain Describe the differences between workgroups and domains, and explain the requirements of joining a domain Explain how the

Ngày tải lên: 06/07/2014, 12:20

... Madrid-based UMAR, our international cement and raw materials trading organization Against a backdrop of turmoil in Asia and excess volumes in the ASEAN na-tions, UMAR performed an important turntable ... growth in “Holder-bank’s” business The gains in effi-ciency achieved in Morocco andLebanon and the encouraging perfor-mance at our grinding stations and import terminal in West Africa are worthy ... large-scale state-backed infrastructure projects In con-trast, building markets in Madagascarand La Réunion experienced an up-swing Capacity utilization rates in some-ternative fuel, petcoke, at the

Ngày tải lên: 27/07/2014, 16:05

... stages in forest plants The beginning of budbreak, leaf unfolding and flowering are usually possible when the air and soil temperature exceed a certain critical point characteristic of each stage ... define and are subject to sudden individual weather events such as a single frost or high winds Available data suggest a delay in autumn events in recent years (Sparks, Menzel 2002) statistical ... the amount of precipitation, air temperature and radiation were monitored in the open area To evaluate phenological data for the characterized period, arithmetic mean, maximum and minimum value,

Ngày tải lên: 07/08/2014, 03:22

... Text, Attribute, and Metadata filters Using combinations of these filters you can search the image library for metadata text, filter searches by flag, copy status, rating, or label, and specify a broad ... bolder areas, while avoiding over-saturating skin colors For this image we’ll leave the Vibrance and Saturation settings as they are and make an adjustment to the Clarity value instead Increasing ... look artificial and color detail will be lost Developing and Editing The Vibrance slider alters the saturation in a non-linear manner—boosting the less saturated colors in a photo and having less

Ngày tải lên: 08/08/2014, 13:21

... (v/v) ethanol, the deproteinized extracts were analyzed by HPAEC-PAD As a standard, a commercial maltodextrin sample (Dextrin 15, Fluka, Germany) was used Data from a single experiment are shown ... using a linear 0–50% (v/v) acetonitrile gradient containing 0.1% (v/v) trifluoroacetic acid A constant flow rate of 100 lLÆmin)1 was applied In the eluate, absorbance was monitored at 214 nm Matrix-assisted ... be metabolized by a complex pathway that includes the action of amylomaltase (malQ), maltodextrin phosphorylase (malP) and maltodextrin glucosidase (malZ) [33] It is not inconceivable that a similar...

Ngày tải lên: 19/02/2014, 16:20

... nymphal instar, steadily declining along the instar, and reaching the lowest values of the instar before the imaginal moult (Fig 3A) In the adult, mRNA levels remained low or even still decreased ... the VgR ligand binding domain of A aegypti and D melanogaster were used to obtain a B germanica homologue cDNA fragment by PCR amplification, using cDNA template generated by reverse transcription ... to that of P americana, in which VgR mRNA levels are relatively high at the beginning of the adult stage, at previtellogenic period, declining on day after the adult emergence, and remaining low...

Ngày tải lên: 16/03/2014, 14:20

... SQL Maintain data DataSet Get data Command Object Maintain data Get data Connection Object DataAdapter Provider Database VB.Net 2005 - Chapter 6 Main Difference:DataSet-DataReader DataSet Data structure ... demand on client memory and CPU System.Data Architecture Program DataReader DataSet DataProvider DataAdapter Database VB.Net 2005 - Chapter Details: System.Data Architecture Program DataReader Action ... Commandn Commandn Which data? DataReadern DataReadern Result 23 VB.Net 2005 - Chapter DataReader Class Datareader and MS Access Store the information obtained by the command In stateless stream...

Ngày tải lên: 13/05/2014, 12:19

... 5’CCTGACTCCAAGACTGTTGGTGATTCCACCAAGATTTGAGGGCTTCC3’, LL814AAFP - 5’GC TGTTAACGCGGCCAATGCCAATGCCACAGC3’, LL814AARP - 5’GGCATTGGCCGCGT TAACAGCACTATTC3’, LL855AAFP - 5’GGGCTTGGAAAGGATTGCGGCATAAGATGGG3’, LL855ARP - 5’CCCATCTTATGCCGCAATCCTTTCCAAGCCC3’ ... 5’GCGGTGGGAGCTGAAGTGGCACAGGC3’, L771/LLLI774SHSSFP - 5’GCTCCCACCGCTCGAAAGACTCACACTCGAATGTAACGAGG3’, L771/LLLI774SHSSRP - 5’CCTCGTTACATTCGAGTGTGAGTCTTTCGAGCGGTGGGAGC3’, LL784HQFP - 5’CGAGGATTGTGGAACTTCTGGGACGCAGGGGG3’, ... motif and those containing the Y712C mutation The MFI Index value was calculated for each of the samples The results indicate that all of the Env CD mutants maintained at least WT levels of surface...

Ngày tải lên: 13/08/2014, 01:20

... DNA-binding domain in the amino-terminus of p65/RelA by cleavage at a sequence near a caspase-3 cleavage site, leaving a carboxy-terminal fragment that contains two potent transactivation domains ... clone in vector pCMV-Tag1 (Stratagene) was obtained from pcDNA3-p65 plasmid using the following primers: p65sNotI, 5'-TCGTAACAACTGCGGCCGCTTGACGCAAATGGGCGGT-3' and p65as, 5'-GCTGGATATCTGCAGAATTCCACC-3' ... Figure Binding affinity assay of p65wt-tag and ΔNH2p65-tag to IκBα by using in vitro translated proteins Binding affinity assay of p65wt-tag and ΔNH2p65-tag to IκBα by using in vitro translated...

Ngày tải lên: 13/08/2014, 05:21