t cell responses during human immunodeficiency virus hiv 1 infection

Báo cáo y học: " Antiretroviral activity of the aminothiol WR1065 against Human Immunodeficiency virus (HIV-1) in vitro and Simian Immunodeficiency virus (SIV) ex vivo" pptx

Báo cáo y học: " Antiretroviral activity of the aminothiol WR1065 against Human Immunodeficiency virus (HIV-1) in vitro and Simian Immunodeficiency virus (SIV) ex vivo" pptx

... support to the notion that the TCBs did not sustain unacceptable toxicity at the doses chosen Anti -HIV- 1 activity of AZT, with and without WR1065, in human TCBs Figure 1B shows inhibition of HIV- 1- replication, ... the p27 Antigen Assay kit (Beckman Coulter, Fullerton, CA) on days 3, 7, 10 , 14 and 17 Results Anti -HIV- 1 activity and cytotoxicity of WR1065 in human TCBs In HIV- 1- infected human TCBs, the HIV- 1 ... for 17 days with the addition of WR1065 Taken together, these studies show inhibition of replication of two distinct retroviruses in TCBs from two different primate species The data suggest that...

Ngày tải lên: 10/08/2014, 05:21

10 348 0
Báo cáo y học: "Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence." doc

Báo cáo y học: "Interactions between human immunodeficiency virus (HIV)-1 Vpr expression and innate immunity influence neurovirulence." doc

... 5’-AGGGGCCAGAGGGGAACT TT; BST-2: forward primer, 5’-AGAAGGGCTTTCAGGATGTG; reverse primer, 5’-CTTTTGT CCTTGG GCCTTCT; HIV- 1 Pol: forward primer, 5’-TTAAGACAGCAGTACAAATGGCAG T; reverse primer, 5’ACTGCCCCTTCACCTTTCCA ... carried out in triplicate at least two times (E-G, Dunnett test, relative to control; *p < 0.05, **p < 0. 01) Na et al Retrovirology 2 011 , 8:44 http://www.retrovirology.com/content/8 /1/ 44 than pVpr77Q-HAD ... restriction site, and reverse primer PHN96-1RM 5’-GGCGGATAC Na et al Retrovirology 2 011 , 8:44 http://www.retrovirology.com/content/8 /1/ 44 CCGCG GCCGCCTAGGATCTACTGGCTCCATTTC, containing Not I...

Ngày tải lên: 13/08/2014, 01:20

17 257 0
Báo cáo y học: " Genotyping of TRIM5 locus in northern pig-tailed macaques (Macaca leonina), a primate species susceptible to Human Immunodeficiency Virus type 1 infection" pps

Báo cáo y học: " Genotyping of TRIM5 locus in northern pig-tailed macaques (Macaca leonina), a primate species susceptible to Human Immunodeficiency Virus type 1 infection" pps

... aaagtgctgggattacaggcatgagctaccgcgcccagcctgtgcttattttcttaaaataatttttgtgg ctttgcag/ACGCTGCCGCCGAGGAAAGTCCTGTACTACTAGCCATGGTCAACCCTACCGTGTTCTTCGAC * ATTGCCGTCGACGGCGAGCCCTTGGGCCGCGTCTCCTTCGAGCTGTTTGCAGACAAGGTTCCAAAGACAGC ... ATTGCCGTCGACGGCGAGCCCTTGGGCCGCGTCTCCTTCGAGCTGTTTGCAGACAAGGTTCCAAAGACAGC AGAAAATTTTCGTGCTCTGAGCACTGGAGAGAAAGGATTTGGTTATAAGGGCTCCTGCTTTCACAGAATTA TTCCAGGGTTTATGTGTCAGGGTGGTAACTTCACACACCATAATGGCACTGGTGGCAAGTCCATCTATGGG GAGAAATTTGAAGATGAGAACTTCATCCTAAAGCATACAGGTCCTGGCATCTTGTCCATGGCAAATGCTGG ... GAGAAATTTGAAGATGAGAACTTCATCCTAAAGCATACAGGTCCTGGCATCTTGTCCATGGCAAATGCTGG ACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGACTGAGTGGTTGGATGGCAAGCATGTGG TCTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGAATGGCAAG ACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCGAATAAAATCGTCGAACGGCAGGCGTGCAAAC...

Ngày tải lên: 12/08/2014, 23:21

12 243 0
Báo cáo y học: " Human immunodeficiency virus type 1 specific cytotoxic T lymphocyte responses in Chinese infected with HIV-1 B''''/C Recombinant (CRF07_BC)" pdf

Báo cáo y học: " Human immunodeficiency virus type 1 specific cytotoxic T lymphocyte responses in Chinese infected with HIV-1 B''''/C Recombinant (CRF07_BC)" pdf

... 11 03 14 4 ± 535 532 ± 10 70 576 ± 16 27 19 76 ± 2624 2 812 ± 4 217 590 ± 11 05 13 2 ± 496 24 ± 11 5 522 ± 988 762 ± 14 83 Total * 413 412 263(63.7%) 296( 71. 8%) 60 (10 0%) 60 (10 0%) 13 283 ± 14 223 15 242 ± 14 353 ... [9 ,10 ,12 ,13 ,29,30] Such clustering pattern of CTL epitopes in HIV- 1 proteins has led to the postulate that the frequency of CTL recognition is inversely correlated with the variability of the ... mounted stronger CTL responses than those with less than 200/mm3 or more than 400/ mm3 The results suggest that the correlation between HIV- specific CTL responses and viral load in HIV- 1 infection...

Ngày tải lên: 13/08/2014, 05:22

12 314 0
Báo cáo sinh học: " Inhibition of human immunodeficiency virus type-1 (HIV-1) glycoprotein-mediated cell-cell fusion by immunor (IM28)" docx

Báo cáo sinh học: " Inhibition of human immunodeficiency virus type-1 (HIV-1) glycoprotein-mediated cell-cell fusion by immunor (IM28)" docx

... 2.5 15 IM28 (ug/ml) Figure IM28 on fusion of TF228 .1. 16 cells with SupT1 cells Effect of3 Effect of IM28 on fusion of TF228 .1. 16 cells with SupT1 cells TF228 .1. 16 cells were mixed with SupT 11 cells ... peptide to the aqueous environment in the vicinity of the target cell initially depends on gp120/ 41 function [11 ] This protein is activated after interacting with primary receptor CD4 This activation ... Effect with TF228 .1. 16 Effect of IM28 and dexamethasone on SupT1 cells co-cultured with TF228 .1. 16 Zoom of negative photomicrograph of SupT1 cultures co-cultivated with TF 228 .1. 16 cells (A) in the...

Ngày tải lên: 18/06/2014, 22:20

6 382 0
Human immunodeficiency virus (HIV)

Human immunodeficiency virus (HIV)

... treatment Gene therapy appears to be a good candidate for future HIV treatment options Anti-retroviral therapy has significantly reduced the death toll associated with AIDS Human hematopoietic ... effective treatment, but resistance occurs, especially after many years of treatment Gene therapy appears to be a good candidate for future HIV treatment options Vaccine and Treatment    It ... of HIV- infected patients, infected macrophages fuse into multinucleated giant cells that produce huge amounts of virus HIV Infection Mechanism Co-receptor CCR5 Permits HIV- 1 Entry •CCR5 is the...

Ngày tải lên: 15/03/2014, 12:57

22 596 1
PULMONARY TUBERCULOSIS AMONG HUMAN IMMUNODEFICIENCY VIRUS (HIV) INFECTED PATIENTS IN THE ERA OF HIGHLY ACTIVE ANTIRETROVIRAL THERAPY (HAART) IN DAR ES SALAAM MUNICIPAL, TANZANIA pdf

PULMONARY TUBERCULOSIS AMONG HUMAN IMMUNODEFICIENCY VIRUS (HIV) INFECTED PATIENTS IN THE ERA OF HIGHLY ACTIVE ANTIRETROVIRAL THERAPY (HAART) IN DAR ES SALAAM MUNICIPAL, TANZANIA pdf

... n =11 1 HIV patients on HAART n= 17 4 TB positive n= 61 Before HAART n=50 TB negative n =11 3 After HAART n =11 Figure Flowchart illustrating current status of tuberculosis among HIV patients 20 There ... Increased mortality during the first month of treatment seems largely attributable to the TB itself (Mukadi et al, 20 01) The greatest proportion of HIV positive associated TB patients are found at CD4 ... Range At TB diagnosis: Total TB positive 11 1 (6- 418 ) After 16 7 (48- 418 Before 10 8 (6-335) At HIV diagnosis: Total TB positive 11 0 (2-358) After 19 0 (2-358) Before 10 8 (6-335) At HAART initiation:...

Ngày tải lên: 22/03/2014, 18:20

38 304 0
Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt

Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt

... CATGGAGATGCAACCTATAATAGTAGCAATAGTAGCATT AGTAGTAGCAATAATAATAGCAATAGCTGTGTGGTCCATAGTAATCATAGAATAGG and NL-TM-R, AATTCCTATTCTATGATTACTATGGACCACACAGCTATT GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; for the ... vpu TM region, R5TM-F, CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGG AGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGTGGACCATAGTATATATAGAATAGG and R5-TM-R, AATT CCTATTCTATATATACTATGGTCCACACGACTATTGCTATGATTAGTGCTA ... italics): For the NL4-3 vpu gene, Vpu-NL-F, GGATCCATGCAACCTATAATAGTA GCAATA and VpuNL-R, GAATTCACTACAGATCATCAATATCCCAAG; for the R5 vpu gene, Vpu-R5-F, GGATCCATGTTAAATTTAGATTATAAATTAGGAGTA GG and...

Ngày tải lên: 18/06/2014, 18:20

11 436 0
Báo cáo hóa học: " Human Immunodeficiency Virus type 1 in seronegative infants born to HIV-1-infected mothers" doc

Báo cáo hóa học: " Human Immunodeficiency Virus type 1 in seronegative infants born to HIV-1-infected mothers" doc

... were studied at different ages (Table 1) The study received approval of the Committee for Human Subject Research (Ministry of Health of México) To detect HIV- 1 sequences in PBMC, two nested polymerase ... first round PCR product was then used as a template in a second PCR reaction with GAG3- Table 1: Detection of HIV- 1 LTR and GAG fragments in PBMC from seronegative infants born to HIV- 1 infected ... detected in the children was integrated into the host genome Additionally total mRNA was extracted from PBMC and HIV- 1 mRNA transcripts were amplified by reverse-transcriptase PCR (data not shown)...

Ngày tải lên: 20/06/2014, 01:20

6 380 0
Báo cáo khoa học: "Atypical presentation of angiosarcoma of the scalp in the setting of Human Immunodeficiency Virus (HIV)" pdf

Báo cáo khoa học: "Atypical presentation of angiosarcoma of the scalp in the setting of Human Immunodeficiency Virus (HIV)" pdf

... that they have no competing interests Authors' contributions PSG participated in the treatment of the patient, collection of case details, literature search and drafted the manuscript The author ... of the http://www.wjso.com/content/7 /1/ 99 neck with the largest noted in the right parotid region measuring 1. 1 cm No distant metastases were noted (Figure 2) She was treated with chemotherapy ... node metastasis [2] There is currently no accepted staging system for this disease [8] Figure Initial presentation Initial presentation There is also no standard treatment schedule for these malignancies...

Ngày tải lên: 09/08/2014, 04:21

4 248 0
Báo cáo y học: "CD4+ T cells spontaneously producing human immunodeficiency virus type I in breast milk from women with or without antiretroviral drugs" potx

Báo cáo y học: "CD4+ T cells spontaneously producing human immunodeficiency virus type I in breast milk from women with or without antiretroviral drugs" potx

... Valea et al Retrovirology 2 011 , 8:34 http://www.retrovirology.com/content/8 /1/ 34 suggest that up to months postpartum, HIV- 1 is mainly transmitted by cells containing the provirus while the cell- free ... detected in breast milk samples with undetectable HIV- 1 RNA suggests that HIV- 1- AgSCs release insufficient levels of HIV- 1 RNA for detection and/or that the time of transit of these cells into ... higher than that of cell- free virus stocks [18 ] Taken together, these observations strongly suggest that cell- associated virus is frequently involved in the transmission of HIV- 1 by breastfeeding HIV- 1...

Ngày tải lên: 13/08/2014, 01:20

12 315 0
Báo cáo y học: "Nef-mediated enhancement of cellular activation and human immunodeficiency virus type 1 replication in primary T cells" docx

Báo cáo y học: "Nef-mediated enhancement of cellular activation and human immunodeficiency virus type 1 replication in primary T cells" docx

... 70 12 15 18 21 6I -1 6I 56 300 240 12 15 18 400 6I -1 6I 18 0 12 0 60 80 0 12 15 18 21 160 14 240 28 6I -1 6I 320 42 10 15 20 25 12 15 18 0 12 15 Days Post-Activation Figure Nef-mediated enhancement ... factors that influence both PAK2 association and T cell activation This interaction is an attractive potential therapeutic target because an inhibitor that blocks the ability of Nef to interact ... 19 1, however, disrupts Nef association with Vav [ 31] and SFKs [ 51] Mutations at position 19 1 (F191H and F191R) not abrogate Nef-mediated enhancement of NFAT activity in cells stimulated for 18 ...

Ngày tải lên: 13/08/2014, 01:21

17 240 0
Báo cáo y học: " MicroRNA profile changes in human immunodeficiency virus type 1 (HIV-1) seropositive individuals" pot

Báo cáo y học: " MicroRNA profile changes in human immunodeficiency virus type 1 (HIV-1) seropositive individuals" pot

... propagation Thus, it has been reported that human miR -12 2 interacts with the 5' UTR of hepatitis C virus (HCV) RNA MiR -12 2, rather than antagonizing HCV replication, appears to augment intracellular ... "Patients" (Figure 5) These results suggest that the state of in vivo HIV- 1 patient PBMCs, as profiled by miRNAs, is more closely modeled by anti-CD3 activation, rather than IL -10 inactivation ... when the majority of the values for that miRNAs were represented by downticks +1 or -1 in the Y-axis represents the two-fold up- or down- cutoffs Note that most values are downticks that exceed the...

Ngày tải lên: 13/08/2014, 05:21

9 190 0
Báo cáo y học: "Dynamic features of the selective pressure on the human immunodeficiency virus type 1 (HIV-1) gp120 CD4-binding site in a group of long term non progressor (LTNP) subjects" pptx

Báo cáo y học: "Dynamic features of the selective pressure on the human immunodeficiency virus type 1 (HIV-1) gp120 CD4-binding site in a group of long term non progressor (LTNP) subjects" pptx

... 3 /13 II F III E I II G III N III D 9 /14 E 5 /14 K II D 19 /19 E I D 9 /10 E 1/ 10 K 11 /11 E 2/7 V N K N H 6 /14 D K N N N T 13 /15 A 2 /15 T 5 /12 A 7 /12 T 1/ 3 A 12 /13 T T T K 15 /15 K 7 /12 E 3 /13 K 12 /12 ... 8 /14 G 13 /13 E 14 /19 K 14 /14 K 19 /19 R 5 /19 V Q 2 /10 V 19 /19 V 7 /11 A 4 /11 A 9/9 (page number not for citation purposes) http://www.retrovirology.com/content/6 /1/ 4 Table 1: Evolution of positively ... selected amino acids that were rarely found in the 500 sequences database K T R T 13 /15 T 6 /14 I 1/ 15 A 1/ 15 I 8 /14 R 11 /13 R 3 /15 R 8 /14 K 2 /13 Arg 81. 3% Lys 18 .4% Met 0% T T 4 /13 I 9 /13 476 Thr...

Ngày tải lên: 13/08/2014, 05:21

15 525 0
Báo cáo y học: " Human Immunodeficiency Virus Type 1 Nef protein modulates the lipid composition of virions and host cell membrane microdomains" pot

Báo cáo y học: " Human Immunodeficiency Virus Type 1 Nef protein modulates the lipid composition of virions and host cell membrane microdomains" pot

... contributes to its enhancement of virion infectivity [18 , 21, 23] We confirm here that in the context of T lymphocyte infection, Nef does not facilitate recruitment of HIV- 1 Gag into DRMs and that ... alterations of the lipidome as a new activity of the HIV pathogenicity factor Nef that might contribute to its multifaceted strategies to manipulate HIV Page of 12 (page number not for citation ... lysates (1% Triton X -10 0) were separated by Optiprep gradient ultracentrifugation, and eight fractions were collected from the top (fraction 1) to the bottom (fraction 8) of the gradient The detergent...

Ngày tải lên: 13/08/2014, 05:22

12 387 0
Báo cáo y học: " The predominance of Human Immunodeficiency Virus type 1 (HIV-1) circulating recombinant form 02 (CRF02_AG) in West Central Africa may be related to its replicative fitness" pps

Báo cáo y học: " The predominance of Human Immunodeficiency Virus type 1 (HIV-1) circulating recombinant form 02 (CRF02_AG) in West Central Africa may be related to its replicative fitness" pps

... set of external primers (envB; 5'-AGAAAGAGCAGAAGACAGTGGCAATGA-3' and ED14; 5'-TCTTGCCTGGAGCTGTTTGATGCCCCAGAC3') and nested primers E80 (5'-CCAATTCCCATACATTATTGTC-3') and E125 (5'-CAATTTCTGGGTCCCCTCCTGAGG-3') ... between dendritic cells and T cells: importance of HIV phenotype, dendritic cell -T cell contact and T- cell activation AIDS 2000, 14 :2299-2 311 Zoeteweij JP, Blauvelt A: HIV- Dendritic cell interactions ... (5'AGAAAGAGCAGAAGACAGTGGCAATGA-3', position 6 216 –6243 on HxB2) and envM (5'-TAGCCCTTCCAGTCCCCCCTTTTCTTTTA-3', position 911 6–9087 on HxB2) Taq Expand Long Template PCR was used according to manufacturer's instructions...

Ngày tải lên: 13/08/2014, 09:20

11 357 0
Báo cáo y học: " Processing sites in the human immunodeficiency virus type 1 (HIV-1) Gag-Pro-Pol precursor are cleaved by the viral protease at different rates" ppt

Báo cáo y học: " Processing sites in the human immunodeficiency virus type 1 (HIV-1) Gag-Pro-Pol precursor are cleaved by the viral protease at different rates" ppt

... Competing interests The author(s) declare that they have no competing interests http://www.retrovirology.com/content/2 /1/ 66 16 17 Authors' contributions JL and SP carried out the experiments RS ... products that likely result from cleavage at the TF F440/L4 41 and TF/PR sites, respectively Lastly, the mature p66/p 51 products represent final cleavage at the PR/RT site Initial cleavage at the ... Fig 1B and 1C show the pattern of cleavage products generated at different time points after the addition of protease in trans We identified over ten distinct species greater than 50 kDa (Fig 1B)...

Ngày tải lên: 13/08/2014, 09:21

6 354 0
mutations on human immunodeficiency virus type 1

mutations on human immunodeficiency virus type 1

... Advantage a Stop viral replication and lead to patient recovery b Inactivated virus or live attenuated virus can be used as vaccine to interfere with the infection of the virulent virus Disadvantage ... Replication – Adsorption /Attachment – Penetration – Uncoating – Biosynthesis – Assembly – Release II Replication  Attachment / Adsorption Attachment / Adsorption II Replication Penetration Mechanisms: ... permissive cells The host cells that can provide the conditions for viral replication III Viral interference: Viral interference When two viruses infect simultaneously one host cell, the virus A...

Ngày tải lên: 15/03/2014, 13:00

51 386 0
w