... progenitor populations were detected Transplantation of a mixture of haematopoietic progenitor cells with either nonfunctioning or wild-type Flt-3 led to reconstitution of the BM cells that mainly ... highly-dependent on the cell type and other growth factors that are acting on the cell FL affects the growth of pluripotent haematopoietic stem cell and progenitor cells and a number of lineages in the ... ability of DC to migrate has allowed them to exert continuous surveillance to foreign antigens or pathogens Immature DC traffic from blood to tissues to capture antigens and then leave the tissues...
Ngày tải lên: 16/09/2015, 15:54
... using the following primers: 5'-TACTGTATCATCTGCTCCTGTAT-3' (outer, antisense), And 5'-TCTGCTCCTGTATCTAATAGAGCTT-3' antisense) (inner, Both primary and secondary PCR reactions contained units of Taq ... detected at this epitope, it is likely that the decline in the p24-specific proliferative response was the key event that contributed to the failure of CTL to control viraemia, as it is understood ... suggest that effective helper T cell function involves proliferation followed by maturation into both effector and costimulatory cells that provide "help" for other lymphocyte functions Thus, antigen-specific...
Ngày tải lên: 13/08/2014, 05:21
gas-phase non-covalent complex - from inclusion complexes to single cell
Ngày tải lên: 14/11/2014, 06:13
More Show Me How: Everything We Couldn't Fit in the First Book Instructions for Life from the Everyday to the Exotic Perfect Paperback
... honey treat sweaty palms Apply ice to the nick Touch up with a styptic pencil Moisten tissue to remove Apply a piece of toilet tissue Try not to shout Wipe hands with talcum powder Give it time ... width Cut foam to dog’s measurements Set on an old quilt Fold over cut to height ; Hem the cut edge Sew Velcro® dots Fasten the dots; sew up open sides Sweet doggy dreams! To make a nutritionally ... fur iture that n doubles as storage space 200 201 straighten a kitchen store clothes efficiently Use hooks everywhere Hang a metal grid to store large kitchen tools Group hanging clothes by type...
Ngày tải lên: 15/01/2014, 12:15
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
... with a 0.22-lM filter (Costar, Cambridge, MA, USA) The GT oligomer sequence was: 5¢-TGT TTG TTT GTT TGT TTG TTT GTT TGT-3¢; and the control CT sequence was: 5¢-TCT TTC TTT CTT TCT TTC TTT CTT TCT-3¢ ... cellular viability, that of the internal-control nontreated cells Preparation of total nuclear extracts Total nuclear extracts were obtained from · 107 cells by using a minor modification of the ... did not bind to the eEF1A of normal human lymphocytes and these cells were not sensitive to the cytotoxic action of the GT It should be noted that nucleolin was also recognized by the GT oligomer...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx
... indicated in the text), were fractionated Then, 40 lg of the particulate (membrane + cytoskeleton) fraction protein was examined by Western blotting to determine whether TCDD treatment caused translocation ... Moreover, we found that PKCh, but not PKCd, was activated in TCDD-treated L-MAT cells We suggest that TCDD treatment of L-MAT cells induces signal transduction, leading to very rapid activation of PKCh, ... prepared from L-MAT cells at 48 h of transfection, and 1.0 mg of total cell protein was then probed by immunoprecipitation and Western blotting to detect the 3·FLAG peptide fused at the C terminus...
Ngày tải lên: 23/03/2014, 13:20
báo cáo hóa học:" Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells" pdf
... load the Figure Cytotoxicity assay Cytotoxicity assay Multiple AAV vectors for DC loading and the autologous targets generated using the IE1 subgenes Targets were generated by viral loading of the ... stimulated AAV/IE1-specific CTLs We analyzed the ability of the AAV/IE1 vectors to generate IE1 specific-CTLs (optimal ratio E :T; 1:20) To analyze CTL activity, we used the following target cell ... restricted Figure demonstrates that the use of AAV/GFP/ Figure Cytotoxicity assay Cytotoxicity assay Killing was stimulated in a dosedependent manner Killing activity was significantly inhibited...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Comparative study on the immunogenicity between an HLA-A24-restricted cytotoxic T-cell epitope derived from survivin and that from its splice variant survivin-2B in oral cancer patients" pot
... as target cells P(-) indicates T2 -A24 target cells without peptide pulsation K562 target cells were used for monitoring natural killer activity and lymphokine-activated non- specific cytotoxicity ... http://www.translational-medicine.com/content/7/1/1 two weeks One week after the 4th stimulation, cytotoxic activity of the CTLs was measured by 51Cr release assay Cytotoxicity assay The cytotoxic activities of CTLs were measured ... twelve patients examined Though the number of patients in this study was too few to discuss the exact correlation, it is possible that the CTL induction efficiency might be related to the disease...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Regulatory activity of azabisphosphonate-capped dendrimers on human CD4+ T cell proliferation enhances ex-vivo expansion of NK cells from PBMCs for immunotherapy" potx
... NK cells initially-obtained their name due to their natural cytotoxicity against tumor cells requiring no prior sensitization, unlike T cells [4] It is well established that the cytotoxicity ... cytotoxic against the K562 cell line and that 3a-G1 doesn 't affect their cytotoxicity when compared with untreated cells [see Additional file 1] Contrary to expectation, we could not demonstrate ... Interestingly, we noticed that these receptors are linked to some extent to T cell proliferation as anti-CD3/CD28 activated T cells have a significantly lower Kd than resting autologous T cells...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata ... gttcttctatgtggccctttgtct tcttgggctctgggtgattc TCRVB12s1, 12s3 VB13A L36092 tggtgctggtatcactgaccaa ggaaatcctctgtggttgatctg TCRVB13s1, 13s6 VB13B X61445 tgtgggcaggtccagtga tgtcttcaggacccggaatt TCRVB13s2, ... tctcgacgccttgctcgtat TCRVB2s1 VB3 U08314 tcctctgtcgtgtggccttt tctcgagctctgggttactttca TCRVB3s1 VB4 L36092 ggctctgaggccacatatgag ttaggtttgggcggctgat TCRVB4s1 VB5 L36092 gctccaggctgctctgttg tttgagtgactccagcctttactg...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: "Comparison of anti-CD3 and anti-CD28-coated beads with soluble anti-CD3 for expanding human T cells: Differing impact on CD8 T cell phenotype and responsiveness to restimulation" pot
... T cells To normalize for the impact of persistent growth attributable to primary stimulation, the ratio of growth after restimulation to growth by matched control cells in the absence of restimulation ... matched control cells also often expanded as well To distinguish true restimulation-dependent growth from persistent expansion still attributable to primary stimulation, we calculated the ratio ... differentiated effector T cells, but unlike conventional effectors [22], the CD45RA+ CD8 T cells noted after anti-CD3 treatment were consistently CD27+ (Figure 3) and CD57- (data not shown) Effector...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... facilitate hematopoietic stem cell transplantation (HSCT) Studies in such patients indicate that Treg cells increase in response to the treatment, and that this effect seems to be increased with ... target organ may disturb the positive feedback loop that controls Foxp3 stability, such that Treg cells convert to Teff cells with a high diabetic potential Moreover, Komatsu et al noted that ... detected in the blood Thus, observations from the blood, if not mimic, at least reflect events ongoing at the specific site of inflammation Whether or not those events that are translated into the...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " Thottapalayam virus is genetically distant to the rodent-borne hantaviruses, consistent with its isolation from the Asian house shrew (Suncus murinus)" potx
... some unidentified rodent host To better characterize the virus and its relationship to other hantaviruses, a study to determine the complete genome of TPM virus was initiated TPM virus (strain VRC ... carboxy-termini in N protein interactions, and although the N protein amino-terminus of TPM virus is highly divergent relative to that of the other hantavirues, it is still predicted to form an anti-parallel ... (5'-TAGTAGTATRCTCCGCARG-3), and HANTA-L-F2, (5'TAGTAGTAGACTCCGGAAG-3') and HANTA-L-R6577 (5'-TAGTAGTATGCTCCGRGAA-3') for M and L segment amplifications, respectively The M segment RT reaction...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "The combined transduction of copper, zincsuperoxide dismutase and catalase mediated by cell-penetrating peptide, PEP-1, to protect myocardium from ischemia-reperfusion injury" ppt
... control SOD1 or CAT These results demonstrate that the PEP-1-SOD1 or PEP-1-CAT fusion proteins were not only able to be transduced into H9c2 cells, but also was the transduced proteins able to ... security Therefore, it is important to find new ways to modify antioxidant enzyme for the efficient introduction into cells Huang et al Journal of Translational Medicine 2011, 9:73 http://www.translational-medicine.com/content/9/1/73 ... limited its usage in protecting cells/tissues from oxidative stress damage There is a growing effort to circumvent these problems by designing strategies to deliver full-length proteins into a...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf
... analyzed by flow cytometry Percentages relative to total CD8+ cells are shown for various cell populations The data are from the experiment shown in Table Page of (page number not for citation purposes) ... residence of the cells Therefore, the conclusion that RSV infection specifically impairs CD8+CTL functionality [1], and the hypothesis that this might contribute to RSV re-infection, must be reassessed ... disruption has been shown to result in attenuation compared to its strain WR parent, yet the virus still causes disseminated infection following IN inoculation [6,11,12] In the present study,...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Characterization of the IFN-γ T-cell responses to immediate early antigens in humans with genital herpes" doc
... significant cross contamination of T- cells in the two different IFN-γ ELISPOT assays is very low To evaluate the activity of T- cells that were bound to magnetic beads, PBMC samples were depleted of either ... these assay conditions The ability of CD8 cells to respond to peptide when bound to beads suggests that antigen presenting cells are not required or are not limiting under the conditions of the ... quantitate this effect the number of all ELISPOTs (E#) measured for each peptide pool was totalled and listed in Table The ELISPOTs for each protein were totalled and the ratio of the ELISPOTs from...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Metabolic and anthropometric parameters contribute to ART-mediated CD4+ T cell recovery in HIV-1-infected individuals: an observational study" potx
... individuals, and to further explore the relationship between lipids and viral control Altogether our data indicate that metabolic parameters contribute to predicting the degree of immune reconstitution achieved ... reconstitution that includes pre-ART viral, immune activation and CD4 + T cell counts The present study followed a cohort of ART-naïve, HIV-infected South African subjects We demonstrate that metabolic ... report that did not detect a lack of response to ART in obese subjects [59], we did observe a negative association between waist/hip ratio and CD4 gain, indicating that subjects with low waist to...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo sinh học: "Life and death as a T lymphocyte: from immune protection to HIV pathogenesis" doc
... within CD4+ T cells, within total T cells or within total hematopoietic cells, or the absolute numbers of Tregs) can greatly influence the outcome of the analysis Part of the problem is that whereas ... called T regulatory cells (Tregs) that suppresses immune activation and is thought to be important in preventing autoimmunity is specifically targeted in the OX40-DTA mouse (The different subsets ... CD8+ T cell numbers that inverts the usual CD4+:CD8+ T cell ratio, and increased serum levels of inflammatory cytokines This generalized activation cannot be attributed to the release of Table Cellular...
Ngày tải lên: 06/08/2014, 19:21