... interface Pro Tools M -Powered Software Pro Tools M -Powered software is a special version of Pro Tools LE designed to work with various affordably priced M-Audio interfaces Pro Tools M -Powered software ... allows you to import and export files compatible with other digital audio and video software xxiii pro tools le and m -powered You can open sessions created in Pro Tools M -Powered software with ... to the latest Pro Tools software (currently version 7.1) from any previous version of Pro Tools LE or Pro Tools M -Powered software What you don’t get in Pro Tools LE and M -Powered So what you...
Ngày tải lên: 06/07/2014, 15:22
... consists of a spool valve and a solenoid coil The spool valve, which acts directly in accordance with electric signals, opens and closes the passage that links the pressure chamber and the pump chamber ... passage between the pressure chamber and pump chamber The pressurized fuel spills into the pump chamber, thus decreasing the pressure in the pressure chamber and ending the pumping of fuel Solenoid ... levels of precision, quick response, and pressure resistance, as well as a large spill volume There are two types of solenoid spill valves: the pilot valve type, and the direct-acting solenoid valve...
Ngày tải lên: 23/10/2012, 09:09
The F# Tool Suite and .NET Programming Tools
... resource files The NET file format is much easier to understand and work with, and also Visual Studio provides some nice resource management tools It is also much easier to localize your applications, ... commands that were added to F# to aid users working with the console, cover the command-line switches it supports, and give some general tips for working with F# interactive fsi.exe Commands ... compiler, that just aren’t relevant to the command-line compiler Table 12-11 describes the fsi.exe commands Table 12-11 The F# Interactive Commands Command Description #r "";; This...
Ngày tải lên: 05/10/2013, 10:20
FreeBSD and Command Line Tools
... flags) r, w, and x meaning user readable, user writable, and user r, w, and x meaning group readable, group writable and group r, w, and x meaning world readable, world writable, and world executable ... List and Status Commands Although each of the utilities for managing RAID levels is different, they have some common commands Every utility accepts the list and status commands The status command ... /mnt/raid5 directory and then run the du command (with the -h flag for human readability and -s for summary) we see that the 239MB listed in the df command is also listed from the du command: freenas:~#...
Ngày tải lên: 19/10/2013, 01:20
Logging and Log-Analysis Tools
... Intelligence, and SenSage These tools all provide for the archival, parsing, and reporting of huge amounts of data, shifting the burden from the security staff and firewall admins to an automated and intelligent ... scripting environment to parse and correlate the logs that are collected or to use third-party log-analysis tools such as Cisco Security Monitoring, Analysis, and Response System (CS-MARS), Net ... firewall to log to a syslog server is a relatively trivial task Example A-8 shows a sample of the commands to be executed Example A-8 Configuring a Cisco Secure PIX Firewall to Use Syslog firewall(config)#...
Ngày tải lên: 28/10/2013, 13:15
Báo cáo khoa học: "A Framework for Unifying Named Entity Recognition and Disambiguation Extraction Tools" pot
... with the goal to highlight strengths and weaknesses and to compare them (Rizzo and Troncy, 2011b) The comparison aggregates all the evaluations performed and, finally, the user is free to select ... 12/10/2011 and we performed the extraction of named entities with the tools supported by NERD The goal is to explore the NE extraction patterns with this dataset and to assess commonalities and differences ... architecture follows the REST principles and provides a web HTML access for humans and an API for computers to exchange content in JSON or XML Both interfaces are powered by the NERD REST engine The...
Ngày tải lên: 08/03/2014, 21:20
Báo cáo khóa học: Mycoplasma pneumoniae HPr kinase/phosphorylase Assigning functional roles to the P-loop and the HPr kinase/phosphorylase signature sequence motif doc
... NaCl were performed between 10 and 150 mM ligand, and, after each titration step, the fluorescence was recorded All curves were integrated between 320 and 380 nm and the relative fluorescence intensity ... of pGP204 and pGP628 using the primers SH1 (5¢-AAACCGCGGCAATGAAAAAG TTATTAGTCAAGGAG) and SH3 (5¢-AAAGGATCC GGTCTGCTACTAACACTAGGATTCATC) The PCR fragments were cut with SacII and BamHI and cloned ... dye-binding assay with BSA as standard was performed using the GRAPHPAD PRISM software (GraphPad Software, Inc.) and a one-site binding model f ¼ [mKAc(ligand)]/[1 + KAc(ligand)], where m is the overall...
Ngày tải lên: 16/03/2014, 16:20
Flash: An Efficient and Portable Web Server pot
... large and growing community of Web users Portable high-performance Web servers reduce the hardware cost of meeting a given service demand and provide the flexibility to change hardware platforms and ... matching or exceeding the performance of MP and MT servers on disk-intensive workloads Moreover, Flash uses only standard APIs and is therefore easily portable Flash’s AMPED architecture behaves ... modern operating systems In a UNIX system, AMPED uses the standard nonblocking read, write, and accept system calls on sockets and pipes, and the select system call to test for I/O completion The...
Ngày tải lên: 16/03/2014, 19:20
Jose m garrido introduction to computational modeling using c and open source tools
... Command B.5.2 The man Command B.5.3 The ls Command B.5.4 The cp Command B.5.5 The mv Command B.5.6 The rm Command B.5.7 The cd Command ... Lucas, and Samuel Williams PROCESS ALGEBRA FOR PARALLEL AND DISTRIBUTED PROCESSING Edited by Michael Alexander and William Gardner SCIENTIFIC DATA MANAGEMENT: CHALLENGES, TECHNOLOGY, AND DEPLOYMENT ... mkdir Command B.5.9 The rmdir Command B.5.10 I/O Re-Direction and Pipe Operators B.6 Shell Variables B.6.1 The pwd Command B.6.2 The more Command ...
Ngày tải lên: 19/03/2014, 14:10
Báo cáo khoa học: Multidrug efflux pumps: The structures of prokaryotic ATP-binding cassette transporter efflux pumps and implications for our understanding of eukaryotic P-glycoproteins and homologues ppt
... between TM helices and and between TM helices and provide noncovalent interactions with sites on the NBD These latter two linker regions, called intracellular loops and (ICL1 and ICL2) can both ... of cross-linking data and ligand docking, chiefly because of the NBD–TMD reverse domain order, the lack of conserved structural motifs ICD2 and ICD3, and shorter TMD helices and low sequence identity ... pair of motions to align the NBDs, thus forming the nucleotide sandwich dimer, and a concomitant retraction of TM1 and TM2 from TM3 and TM6, generating an outward facing configuration of the TMDs...
Ngày tải lên: 22/03/2014, 21:20
principles of chemical reactor analysis and design new tools for industrial chemical reactor operations
... constant, and Deff is the effective diffusion coefficient in the particle (depending on the reactants and products, the size and size distribution of the pore, and the porosity of the pellet), and L ... it requires knowledge of the local temperature and flow patterns (hydrodynamics) and numerous physical and chemical properties (porosity, pore size and size distribution, viscosity, diffusion coefficients, ... of reactor hydrodynamics [40–43] High speed and reduced cost of computation and increased cost of laboratory and pilot-plant experimentation make such tools increasingly attractive The utility...
Ngày tải lên: 01/04/2014, 10:36
Thermodynamics and heat powered cycles (malestrom)
... joule, and watt often prove to be rather small We frequently encounter several thousand newtons, several thousand joules, several thousand pascals, or several thousand watts In such cases and particularly ... exergy, heat, work, and matter Thermodynamics likewise covers broad and diverse fields Basic to the study of thermodynamics are definitions and concepts, properties of substances and changes thereof ... engines, refrigerators, and heat pumps The revolution began with coal, and has progressed through the use of petroleum, natural gas and uranium Hydroelectric, solar, wind, tidal, and geothermal power...
Ngày tải lên: 08/04/2014, 11:43
conte r., magri f., musette m., satsuma j, and winternitz p. direct and inverse methods in nonlinear evolution equations, greco a. m.
... the geometrical approach and cover a large amount of topics concerning both the finite and infinite dimensional manifolds, Conte and Musette explain as Painlev´ analysis and its various extensions ... carefully edited and closely related to each other Each contribution should contain at least partly original and previously unpublished material, be written in a clear, pedagogical style and aimed at ... if they not meet the high quality standards of this series The final manuscript must be ready to print, and should include both an informative introduction and a sufficiently detailed subject index...
Ngày tải lên: 24/04/2014, 16:50
novikov s.p. solitons and geometry (lezioni fermiane, cambridge univ. press, 1994, web draft, 1993)
... Jacobi identity Many people worked on this (for example I Gelfand and L Dickey in 1978, I Gelfand and I Dorfman in 1979 and 1981, A Astashov and A Vinogradov in 1981 —see the references quoted in [10]) ... Lie about 100 years ago and later rediscovered by F Beresin in 1960; it has been seriously used by Kirillov and Costant in representation theory —see [7] and [12] (For this and the next example ... n = and N = 3; H Flashka, G Forest and D McLaughlin in 1980 for N = 2m + and n = 1) The differential-geometric Hamiltonian formalism (above) for these HT systems was developed by B Dubrovin and...
Ngày tải lên: 24/04/2014, 16:50
managing virtual teams getting the most from wikis, blogs, and other collaborative tools
... the Tools, ” describes the different features of each type of tool, and shows some of the differences (and similarities) between the tools available today Caution: New virtual and collaborative tools ... Dave Antonie, Sarah and Todd Harris, Elton and Kathy Hall, and Elizabeth Greene have been stalwart friends and advisors Many thanks to Lisa Claypool-Lund, Dave Hoekstra, and the rest of the Loomis ... areas together Managers need to understand what tools and technologies are available in order to make good choices, and they need to be able to use these tools to support good management practices...
Ngày tải lên: 01/06/2014, 09:24
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx
... seronegative infants and young children Methods Cells and viruses LLC-MK2 cells (ATCCCCL7.1) and HEp-2 cells (ATCCCCL23) were maintained in Opti-MEM I (GibcoInvitrogen, Inc Grand Island, NY) supplemented ... recovered virus and performed in vitro and in vivo studies SRS recovered viruses and assisted with in vivo studies PLC contributed to the study design and drafting of the manuscript MHS and BRM supervised ... vaccine candidates contained at least one genetically stabilized ts and non-ts att mutation These viruses were evaluated for their in vitro attenuation phenotype and for replication, efficacy and...
Ngày tải lên: 18/06/2014, 18:20