structure bioavailability and metabolism of flavan 3 ols and procyanidins

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... spectrometry and assigned to be free CoA (peak 1), acetyl-CoA (peak 2) (Z) -3- MG-5-CoA (peak 3) (E) -3- MG-5-CoA (peak 4) and (E) -3- MG-1-CoA (peak 5) The determined relative molecular masses (MW) of the 3- MG-CoA ... of (Z) -3- MG-5-CoA is probably due to the possible trans-conformation of the C5-carboxyl group of (Z)-3methylglutaconate (Fig 4) Most of (Z) -3- MG-5-CoA was hydrolyzed by AUH to give free CoA and ... incubation of 3- methylcrotonyl-CoA with 3- methylcrotonyl-CoA-carboxylase in the presence of NaH14CO3 In this work, Km values for the hydration of [5-14C ]3- MG-CoA of 6.9 lm (fibroblast) and 9.4 lm...

Ngày tải lên: 19/02/2014, 07:20

11 625 0
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot

Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot

... 4.82 3. 53 3. 43 3.72 3. 53 3. 43 3.72 Proton (1H) Chemical shift (p.p.m.) Proton (1H) Chemical shift (p.p.m.) GalNAc:H1 GalNAc:CH3 GalNAc:H3 GalNAc:H1 Gal:H2 Gal:H2 4.79 1.79 3. 77 4.79 3. 53 3. 53 10ThrcCH3 ... GalNAc:H3 GalNAc:H3 Gal:H1 Gal:H1 Gal:H2 GalNAc:CH3 GalNAc:CH3 GalNAc:CH3 4.79 3. 77 3. 77 4.82 4.82 3. 53 1.79 1.79 1.79 GalNAc:H2 GalNAc:H2 Gal:H1 Gal:H2 Gal:H3 Gal:H4 Gal:H2 Gal:H3 Gal:H4 3. 95 3. 95 ... 2,2-dimethyl-2-silapentane-5-sulfonate) 3Jx,y, 3- bond coupling constant GalNAc Gal Proton (1H) 13 H1 H2 H3 H4 4.79 3. 94 3. 78 3. 48 1 03. 2 52.2 77.4 75.8 4.82 3. 55 3. 44 3. 76 GalNAc Gal 4.25 7.92 4.6 4.25...

Ngày tải lên: 23/03/2014, 13:20

11 566 0
Báo cáo khoa học: Structure and function of the 3-carboxy-cis,cis-muconate lactonizing enzyme from the protocatechuate degradative pathway of Agrobacterium radiobacter S2 pdf

Báo cáo khoa học: Structure and function of the 3-carboxy-cis,cis-muconate lactonizing enzyme from the protocatechuate degradative pathway of Agrobacterium radiobacter S2 pdf

... 26.21 30 578 1252 87 30 585 825 25 33 .3 28.7 63. 6 49.0 33 .0 74.2 0.010 1.457 0.011 1.4554 92.7 7 .32 91 .3 8.75 a Rmerge ¼ Si ŒIi – ÆI æŒ ⁄ S ÆI æ, where I is an individual intensity measurement and ... 208.51, c ¼ 1 23. 93, b ¼ 108 .35 99.5 (99.5) 8.6 (45.4) 12.1 (3. 0) 18.8 23. 6 20–2.6 (2.7–2.6) 0. 931 446 581 (42 109) 133 154 ( 13 747) P212121 a ¼ 94. 03, b ¼ 205 .32 , c ¼ 235 .74 94.6 (92.4) 10.1 (47.9) ... relative kcat ⁄ Km for 3SM versus 3CM of 0. 73 and 0.21, respectively [15] Nonetheless, ArCMLE1 catalyzes the lactonization of 3SM better in terms of kcat and kcat ⁄ Km than any of the type II enzymes...

Ngày tải lên: 30/03/2014, 10:20

14 326 0
Microbial community structure in anaerobic degradation of terephthalate and phenol 3

Microbial community structure in anaerobic degradation of terephthalate and phenol 3

... (ºC) Reactor volume (L) Full − 1280 m3 Lab 37 0.66 Lab 37 2.8 Lab 37 2.8 Lab 37 2.8 Sucrose ( 134 ) 0 .33 0.5 Phenol/p -cresol: 800 /30 0 − Lab 35 2.0 0.5 37 2.0 Lab 30 0.16 Lab 26 2.8 Phenol: 1260 Phenol: ... 6-diamidino-2-phenylindole (DAPI) 48 Materials and Methods Table 3. 3 lists the oligonucleotide probes used in this study, including EUBmix (i.e., EUB 338 , EUB 338 -II, EUB 338 -III) that targets most of the Bacteria (Amann ... and T; S: G and C; R: A and G; M: A and C For primer 968F-GC, a 40-bp GC clamp (5’- CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGG -3 ) was included at the 5’ end 43 Materials and Methods 3. 3 .3 T-RFLP...

Ngày tải lên: 11/09/2015, 16:05

160 308 0
solutions to exercises and problems of Introduction of algorithm 3 (Bài giải sách Introduction of algorithm )

solutions to exercises and problems of Introduction of algorithm 3 (Bài giải sách Introduction of algorithm )

... i3 i Cn ! iD1   n   n3 3n D c 2 C Cn 3 1/2   3n n D cn3 Cc Cn c D cn3n C 2n C 3n /  cn3n for all c > 0, n  (see below) Selected Solutions for Chapter 15: Dynamic Programming 15 -3 ... n ! 1 =3/ n ! 1 =3/ 2 n !    ! Since 1 =3/ k n D when k D log3 n, the height of the part of the tree in which every node has two children is log3 n Since the values at each of these levels of the ... each such value of n and determine a value of c for which < cx for all values of n The final value of c that we use is the larger of   6, which works for all n  n0 , and max3n

Ngày tải lên: 02/11/2013, 08:12

70 1,1K 0
Tài liệu Chapter 2: Indicators of Financial Structure, Development, and Soundness ppt

Tài liệu Chapter 2: Indicators of Financial Structure, Development, and Soundness ppt

... institutions and their asset positions, and (b) the number of and growth rates of 10 11 12 A B C D E F G H I 16 Chapter 2: Indicators of Financial Structure, Development, and Soundness available money and ... (%) Size of derivative markets • • • • Types and number of schemes (unique and mixed funds) Total assets and growth rates (nominal and as percentage of GDP) Total number of investors and average ... • • • • Number of listed securities (bonds and equities) Share of households, corporations, banks, and NBFIs in the holdings of securities Number and value of new issues (bonds and equities) Market...

Ngày tải lên: 17/12/2013, 05:15

19 546 0
Tài liệu Golf and the game of leadership 3 ppt

Tài liệu Golf and the game of leadership 3 ppt

... one of the most influential management teachers of our time In 1995, Herzberg’s book, Work and the Nature of Man, was listed as ‘‘one of the ten most 10589$ $CH1 02- 23- 04 16:44:17 PS 13 You’ve ... the job Achievement and recognition are 10589$ $CH1 02- 23- 04 16:44:18 PS 14 Golf and the Game of Leadership short-term motivators and need repetition Awards, promotions, and merit salary increases ... Lopez, member of the LPGA Hall of Fame and the World Golf Hall of Fame Golf is a simple game There are a series of 18 small holes, filled with cups, spread over an appealing, well-tended landscape...

Ngày tải lên: 24/12/2013, 16:15

10 580 0
Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf

Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf

... Biol 13, 2486–2496 19 Fernandes M, O’Brien T & Lis JT (1994) Structure and regulation of heat shock gene promoter In The Biology 5880 20 21 22 23 24 25 26 27 28 29 30 of Heat Shock Proteins and ... regulators of stress response and apoptosis Cell Stress Chaperones 3, 228– 236 Hendrick JP & Hartl F-U (19 93) Molecular chaperone functions of heat-shock proteins Annu Rev Biochem 62, 34 9 38 4 Bukau ... Phosphorylated STAT3 (Tyr705) (p-STAT3), STAT3, Hsp105, Hsp70 and a-tubulin were analyzed by western blotting, using the respective antibodies (B) These cells were stained with Hoechst 33 342 (blue), and the...

Ngày tải lên: 18/02/2014, 06:20

11 585 0
Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf

Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf

... in single, human platelets Regulation by 38 4 30 31 32 33 34 35 36 37 38 39 40 41 modulation of the inositol trisphosphate receptors Eur J Biochem 269, 15 43 1552 Fischer L, Gukovskaya AS, Young ... condition of AR-C + thrombin; *P < 0.05 (n = 4–6) 37 4 ± ± ± ± ± ± 38 (100%) 69 (91%)* 142 (100%) 131 (119%) 1 03 ( 93% )* 131 (87%)* ± ± ± ± ± ± 30 32 2660 4098 7418 2784 34 21 (100%) (66%)* (72%)** ( 135 %)* ... equation of Fluo -3 for Ca2+ [27] Ultra-pure calcium-free water was used for preparation of all buffers and (ant)agonists Measurement of cytosolic cAMP and InsP3 Intracellular levels of cAMP and InsP3...

Ngày tải lên: 18/02/2014, 16:20

15 565 0
Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx

Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx

... In addition, A 35 0 20(OH)D3 Response (mV) 30 0 250 (OH)D3 RT32 200 20, 23( OH) D3 150 D3 (OH) D3 RT26.7 (OH) D3 RT26 100 (OH) D3 RT22 50 10 20 30 40 50 Time (min) B 500 100 400 D3 90 30 0 80 200 70 ... Vitamin D3 20(OH)D3 30 20, 23( OH) D3 20 10 0 50 100 150 200 Time (min) Secosteroid (mol·mol–1 P450scc) B 20, 23( OH)2D3 (OH)2D3 RT26 (OH)3D3 RT22 (OH)D3 RT26.7 (OH)D3 RT32 to K+ (400.4 + 39 ), whereas ... 2587 Metabolism of vitamin D3 by cytochrome P450scc R C Tuckey et al Metabolism of 20-hydroxyvitamin D3 and 20, 23- dihydroxyvitamin D3 by P450scc A Secosteroid (mol·mol–1 P450scc) 40 20(OH)D3 RT33...

Ngày tải lên: 18/02/2014, 17:20

12 706 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

... GTGGATCCTGATCCCTCAGGGCTC -3 ; sense primer) vs its complement generating pGL3b:Prm3AP)1*, pGL3e: Prm3AP)1*, pGL3b: Prm3aAP)1*, pGL3e:Prm3aAP)1*, pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b: Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, ... AG -3 , corresponding to NTs )404 to )38 6) (3) Prm3ab, pGL3b:Prm3ab & pGL3e:Prm3ab (Primer Kin146; 5¢-dGAGAGGTACCTGGGAGGCTGAGATGG3¢, corresponding to NTs )32 0 30 4) (4) Prm3aa, pGL3b:Prm3aa & pGL3e:Prm3aa ... Prm3 () 139 4 to +1), Prm3a ()404 to +1), Prm3ab ( )32 0 to +1), Prm3aa ()154 to +1), Prm3aaa ()50 to +1) or their respective site-directed variants Prm3AP)1*, Prm3aAP)1*, Prm3abAP)1*, Prm3aaAP)1* and...

Ngày tải lên: 19/02/2014, 16:20

18 510 0
Tài liệu Báo cáo khoa học: Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-D-glyceric acid Selective inhibition by structure-based design docx

Tài liệu Báo cáo khoa học: Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-D-glyceric acid Selective inhibition by structure-based design docx

... Trypanosoma brucei glyceraldehyde -3- phosphate 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 dehydrogenase by 1 ,3- diPG analogues Bioorg Med Chem 9, 7 73 7 83 Ladame, S., Claustre, S & Willson, ... 900 200 700 HOP Inhibition and site-directed mutagenesis of T brucei gGAPDH In the absence of a 3D structure of a complex of T brucei gGAPDH with an analogue of 1 ,3- BPGA, we chose to investigate ... Biochemistry 34 , 14975–14986 ´ 23 Duee, E., Olivier-Deyris, L., Fanchon, E., Corbier, C., Branlant, G & Dideberg, O (1996) Comparison of the structures of wildtype and a N313T mutant of Escherichia...

Ngày tải lên: 20/02/2014, 02:21

13 594 0
Tài liệu Báo cáo khoa học: Multidentate pyridinones inhibit the metabolism of nontransferrin-bound iron by hepatocytes and hepatoma cells docx

Tài liệu Báo cáo khoa học: Multidentate pyridinones inhibit the metabolism of nontransferrin-bound iron by hepatocytes and hepatoma cells docx

... 10.9 13. 0 17.0 5 .3 8.6 13. 3 Cytosol 26.0 27.1 25.6 23. 6 30 .8 23. 0 38 .2 5.8 30 .6 47.4 18 .3 9.6 8.8 15.8 ± ± ± ± ± ± ± 1.1 6.4 2.5 6.4 17.8 8.8 2.8 ± ± ± ± ± ± ± Ferritin 0 .3 3.2 27.4 6.1 3. 5 4.5 ... ± ± 0 .32 0 .38 0.42 0.20 0. 43 0 .32 0 .32 0.66 0.18 0.17 0. 13 0.16 0.42 0.20 0.24 1.40 0. 73 0.79 ± ± ± ± ± ± ± ± ± 0.89 1.04 1.05 0.76 0.78 0.84 2.04 0.84 3. 36 0. 23 0.05 0. 43 0.11 0.05 0 .36 0.12 ... 0. 83 0.61 0.87 0.46 0.69 0.25 0.56 1.22 0.45 0.21 0.19 1.59 0.88 0.50 0. 03 0.12 4.65 0. 63 ± ± ± ± ± ± ± ± ± Membrane fraction Membrane fraction 2.45 2.21 2. 43 3.49 3. 27 2 .31 3. 52 3. 64 3. 91 3. 63...

Ngày tải lên: 20/02/2014, 11:20

10 545 0
Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx

Tài liệu Báo cáo khoa học: Inhibition of glyceraldehyde-3-phosphate dehydrogenase by peptide and protein peroxides generated by singlet oxygen attack docx

... Biochem J 30 5, 6 436 49 33 Davies, M.J (1996) Protein and peptide alkoxyl radicals can give rise to C-terminal decarboxylation and backbone cleavage Arch Biochem Biophys 33 6, 1 631 72 34 Gebicki, ... Inhibition of glyceraldehyde -3- phosphate dehydrogenase on incubation with H2O2, and peptide- and protein-peroxides, in the presence and absence of added Fe2+EDTA GAPDH was incubated at 37 C for 30 with ... ions [25 ,32 ,33 ] Though it is possible that the inactivation of GAPDH and GR occurs via oxidation of nonactive site residues, that bring about loss of functional integrity, the stoichiometry of inactivation...

Ngày tải lên: 21/02/2014, 03:20

10 464 0
Tài liệu Structure Development and Mechanical Performance of Polypropylene docx

Tài liệu Structure Development and Mechanical Performance of Polypropylene docx

... iPP1 2.7·1014 38 3 0.181 4.5·10−6 * 36 3* 2 .3 10 3 * 7.4·10−7 30 8 2.7·10 3 iPP2 1.2·1014 38 3 0.219 4.5·10−6 * 36 3* 2 .3 10 3 * 7.4·10−7 30 8 2.7·10 3 1.0·10−6 † 37 7 3. 5·10 3 unit [m 3 ] [K] [K−1 ] ... Varga, and G Moln´ r Journal of Thermal Analysis and Calorimetry 83( 3):625– 630 , 2006 a a [12] K Mezghani and P J Phillips Polymer 38 ( 23) :5725–5 733 , 1997 [ 13] K Mezghani and P J Phillips Polymer 39 (16) :37 35 37 44, ... 1940 [30 ] A N Kolmogoroff Isvest Akad Nauk SSSR Ser Math 1 :33 5 33 9, 1 937 [31 ] G Lamberti Polymer Engineering and Science 51(5):851–861, 2011 [32 ] H Ito, Y Tsutsumi, K Minagawa, J Takimoto, and...

Ngày tải lên: 22/02/2014, 09:20

156 430 0
Báo cáo khoa học: Proteomic and biochemical analysis of 14-3-3-binding proteins during C2-ceramide-induced apoptosis pot

Báo cáo khoa học: Proteomic and biochemical analysis of 14-3-3-binding proteins during C2-ceramide-induced apoptosis pot

... MDA-MB- 231 14 -3- 3-binding status during apoptosis MDA-MB- 435 EvsaT HeLa M Pozuelo-Rubio 14 -3- 3γ 14 -3- 3ζ 14 -3- 3ε 14 -3- 3σ 14 -3- 3θ Tubulin Fig Analysis of expression levels of several 14 -3- 3 isoforms ... Titin 33 28 Control Ceramide CaM Centrosomal Nek2-associated protein TSC2 Myosin light chain kinase 14 -3- 3f ⁄ d 14 -3- 3e 14 -3- 3c 14 -3- 3h 14 -3- 3g B-cell scaffold protein with ankyrin repeats 14 -3- 3f ... Pozuelo-Rubio 31 32 33 34 35 36 37 38 39 40 41 42 43 44 ceramide-mediated stress signal in colon cancer cells by 2-D gel electrophoresis and MALDI-TOF-MS J Proteome Res 4, 870–880 Pandey S, Murphy...

Ngày tải lên: 06/03/2014, 22:21

22 425 0
LONG TERM CHANGES IN VOTING POWER AND CONTROL STRUCTURE FOLLOWING THE UNIFICATION OF DUAL CLASS SHARES pdf

LONG TERM CHANGES IN VOTING POWER AND CONTROL STRUCTURE FOLLOWING THE UNIFICATION OF DUAL CLASS SHARES pdf

... performance and capital structure of Canadian firms Journal of Banking and Finance 32 , 24 23- 2 432 Kosenko, K (2008) Evolution of business groups in Israel: Their impact at the level of the firm and the ... IM 22.2009 IM 23. 2009 SD 24.2009 IM SD 25.2009 26.2009 IM SD SD 27.2009 28.2009 29.2009 SD SD 30 .2009 31 .2009 SD SD SD SD 32 .2009 33 .2009 34 .2009 35 .2009 SD SD SD 36 .2009 37 .2009 38 .2009 Michael ... T., and Yafeh, Y (2007) Business groups in emerging markets: Paragons or parasites? Journal of Economic Literature 45, 33 1 -37 3 24 King, M.R and Santor, E (2008) Family values: Ownership structure, ...

Ngày tải lên: 07/03/2014, 01:20

46 357 0
Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

Báo cáo khoa học: Discovery and characterization of a Coenzyme A disulfide reductase from Pyrococcus horikoshii Implications for the disulfide metabolism of anaerobic hyperthermophiles doc

... Thermostability and thermoactivity of the CoADR phCoADR is stable for months at both )80 °C and )20 °C, and has half-lives of > 100 and 39 h at 85° and 95 °C, respectively Figure shows the dependence of the ... disulfides, and assayed as above Thiols were quantified by comparison of peak areas to standard curves of those standards Coenzyme A was measured as the sum of the areas of the CoA and dephospho ... which corresponds to the 38 0 and 36 0 nm peaks of the E and EH2 forms, respectively This result is inconsistent with reduction of the FAD and consistent with the formation of an EH2Æ NADPH complex,...

Ngày tải lên: 07/03/2014, 17:20

12 421 0
Báo cáo khoa học: Uptake and metabolism of [3H]anandamide by rabbit platelets Lack of transporter? ppt

Báo cáo khoa học: Uptake and metabolism of [3H]anandamide by rabbit platelets Lack of transporter? ppt

... rapid uptake of [3H]anandamide by Ó FEBS 20 03 Uptake and metabolism of anandamide by rabbit platelets (Eur J Biochem 270) 35 01 Fig Effect of caffeic acid and indomethacin on [3H]anandamide metabolism ... uptake and degradation of anandamide and palmitoylethanolamide in leukocytes J Biol Chem 272, 33 15 33 23 13 Maccarrone, M., Bari, M., Menichelli, A., Del Principe, D & ` Finazzi Agro, A (1999) Anandamide ... in Fig 7, the profile of [3H]anandamide uptake was identical at 37 °C and 25 °C At these two temperatures, the metabolism of [3H]anandamide took place to the same extent and resulted in the same...

Ngày tải lên: 08/03/2014, 08:20

9 310 0
Báo cáo Y học: Structure, mechanism and function of prenyltransferases docx

Báo cáo Y học: Structure, mechanism and function of prenyltransferases docx

... summarizes the 3D structures, IPP condensation kinetics and mechanism of trans-IPPS and cis-IPPS for the production of linear polyprenyl pyrophosphates, and the reaction mechanism and structures of protein ... Chem 267, 218 73 21878 Ó FEBS 2002 Structure, mechanism and function of prenyltransferases (Eur J Biochem 269) 33 53 52 Joly, A & Edwards, P.A (19 93) Effect of site-directed mutagenesis of conserved ... distance of the diphosphate Mutations of His248b, Arg291b, Lys294b, Tyr300b, and Trp303b cause 3 15 times increased FPP Kd compared with the wild-type FTase [ 83] , consistent with the crystal structure...

Ngày tải lên: 08/03/2014, 22:20

16 530 0

Bạn có muốn tìm thêm với từ khóa:

w