stress and strain analysis of a quantum dot heterostructure

Comparative metabolic and transcriptional analysis of a doubled diploid and its diploid citrus rootstock (C. junos cv. Ziyang xiangcheng) suggests its potential value for stress resistance

Comparative metabolic and transcriptional analysis of a doubled diploid and its diploid citrus rootstock (C. junos cv. Ziyang xiangcheng) suggests its potential value for stress resistance

... and thicker leaf, larger stomata size and lower stomata density (Figure and Additional file 2) Additionally, enlargement in leaf structure of 4x was observed by anatomical analysis (Additional ... Morphological characterization ofand 4× Ziyang xiangcheng (A) 2× and 4× seedlings; (B) Leaves ofand 4×; (C), (D) Stomata size ofand 4×; (E), (F) Stomata density ofand 4× Tan et al BMC ... spectrometry) analysis revealed that tetraploidization has an activation effect on the accumulation of primary metabolites in leaves; many stress- related metabolites such as sucrose, proline and γ-aminobutyric

Ngày tải lên: 26/05/2020, 23:55

14 63 0
Design, simulation, fabrication and performance analysis of a piezoresistive micro accelerometer

Design, simulation, fabrication and performance analysis of a piezoresistive micro accelerometer

... application of accelerations Ax, Ay, and Az.59 Table Resistance changes due to application of accelerations Ax, Ay, and Az.61 Table Performance parameters of the sensor 72 Table The comparison ... Modeling and Simulation of Microsystems, Semiconductors, Sensors and Actuators, Santa Clara, CA, pp 308-313 Design, Simulation, Fabrication and Performance Analysis of a Piezoresistive Micro Accelerometer ... Simulation, Fabrication and Performance Analysis of a Piezoresistive Micro Accelerometer LIST OF TABLES Table Comparing mechanical properties among several materials in Ref [18] which are extracted

Ngày tải lên: 19/11/2017, 02:00

126 263 0
Design, simulation, fabrication and performance analysis of a piezoresistive micro accelerometer

Design, simulation, fabrication and performance analysis of a piezoresistive micro accelerometer

... application of accelerations Ax, Ay, and Az.59 Table Resistance changes due to application of accelerations Ax, Ay, and Az.61 Table Performance parameters of the sensor 72 Table The comparison ... Modeling and Simulation of Microsystems, Semiconductors, Sensors and Actuators, Santa Clara, CA, pp 308-313 Design, Simulation, Fabrication and Performance Analysis of a Piezoresistive Micro Accelerometer ... Simulation, Fabrication and Performance Analysis of a Piezoresistive Micro Accelerometer LIST OF TABLES Table Comparing mechanical properties among several materials in Ref [18] which are extracted

Ngày tải lên: 03/03/2018, 09:53

126 168 0
Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae

Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae

... on the B rapa chromosomes also showed that they were Table Distribution of Monkey King elements in B rapa, A lyrata and A thaliana genome B rapa A lyrata A thaliana Chr no Size of No of Chr (Mb) ... shift assay (EMSA) analysis, identification of a Monkey King-related microRNA (miRNA), and transgenic analysis revealed its effects on gene expression and genome evolution in Brassicaceae Results ... Page of 14 Table Summary of the insertion positions of complete Monkey King elements in the genomes of B rapa and A thaliana Insertion position B rapa A thaliana No of elements Percentage No of

Ngày tải lên: 26/05/2020, 20:55

14 39 0
Design, simulation, fabrication and performance analysis of a piezoresistive micro accelerometer

Design, simulation, fabrication and performance analysis of a piezoresistive micro accelerometer

... Table 3 Resistance changes due to application of accelerations Ax, Ay, and Az.59 Table Resistance changes due to application of accelerations Ax, Ay, and Az.61 Table Performance parameters of ... magnetic, and optical sensors”, Sensors and Actuators A: Physical Vol.58(2), pp 87-100 [68] T.Mineta, S.Kobayashi, Y.Watanabe, S.Kanauchi, I.Nagakawa, E.Suganuma, M.Esashi, (1995), Three-axis capacitive ... Modeling and Simulation of Microsystems, Semiconductors, Sensors and Actuators, Santa Clara, CA, pp 308-313 Design, Simulation, Fabrication and Performance Analysis of a Piezoresistive Micro Accelerometer

Ngày tải lên: 30/07/2020, 14:16

130 21 0
Design, simulation, fabrication and performance analysis of a piezoresistive micro accelerometer

Design, simulation, fabrication and performance analysis of a piezoresistive micro accelerometer

... application of accelerations Ax, Ay, and Az.59 Table Resistance changes due to application of accelerations Ax, Ay, and Az.61 Table Performance parameters of the sensor 72 Table The comparison ... Modeling and Simulation of Microsystems, Semiconductors, Sensors and Actuators, Santa Clara, CA, pp 308-313 Design, Simulation, Fabrication and Performance Analysis of a Piezoresistive Micro Accelerometer ... Simulation, Fabrication and Performance Analysis of a Piezoresistive Micro Accelerometer LIST OF TABLES Table Comparing mechanical properties among several materials in Ref [18] which are extracted

Ngày tải lên: 01/08/2020, 21:06

126 20 0
an efficient spectral element model with electric dofs for the static and dynamic analysis of a piezoelectric bimorph

an efficient spectral element model with electric dofs for the static and dynamic analysis of a piezoelectric bimorph

... Fernandes and J Pouget, “An accurate modelling of piezoelectric multi-layer plates,” European Journal of Mechanics A, vol 21, no 4, pp 629–651, 2002 [4] R P Khandelwal, A Chakrabarti, and P Bhargava, ... plates,” ASME Journal of Applied Mechanics, vol 71, no 5, pp 604–614, 2004 [20] V M Franco Correia, M A Aguiar Gomes, A Suleman, C M Mota Soares, and C A Mota Soares, “Modelling and design of adaptive ... Mechanics of Laminated Composite Plates and Shells: Theory and Analysis, CRC Press, Boca Raton, Fla, USA, 2003 [28] P Phung-Van, T Nguyen-Thoi, T Le-Dinh, and H NguyenXuan, “Static and free vibration

Ngày tải lên: 02/11/2022, 08:52

10 10 0
identification and transcript analysis of a novel wallaby macropus eugenii basal like breast cancer cell line

identification and transcript analysis of a novel wallaby macropus eugenii basal like breast cancer cell line

... Figure analyses of normal tammar wallaby mammary gland and primary breast cancer from the same animal Histological Histological analyses of normal tammar wallaby mammary gland and primary breast cancer ... South Australia Care and treatment of animals conformed to the National Health and Medical Research Council of Australia and were approved by the Victorian Department of Sustainability and Environment ... mammary carcinoma in a tammar wallaby was examined by histopathological techniques and a breast cancer cell line was established (WalBC) Transcriptional profiling using a custom tammar wallaby

Ngày tải lên: 02/11/2022, 11:35

14 8 0
Simulation and analysis of a novel micro-beam type of mems strain sensors

Simulation and analysis of a novel micro-beam type of mems strain sensors

... direction of the stress and strain on the material objects MATERIALS AND METHODS 2.1 Theoretical background for mechanical analysis system In this theoretical analysis, the strain gauge problem can ... element of the material To relate stress and strain, we need to provide a material law In the assumption of linear relations between stress and strain, we can write the general form of Hook’s law: ... loads and dimensions of the strain beam Thus, the MEMS strain gauge can be operated safely to avoid the break of strain gauge in wide range of the distributed tension loads and dimensions of strain

Ngày tải lên: 13/01/2020, 12:21

11 31 0
Báo cáo Y học: A comparative biochemical and structural analysis of the intracellular chorismate mutase (Rv0948c) from Mycobacterium tuberculosis H37Rv and the secreted chorismate mutase (y2828) from Yersinia pestis pptx

Báo cáo Y học: A comparative biochemical and structural analysis of the intracellular chorismate mutase (Rv0948c) from Mycobacterium tuberculosis H37Rv and the secreted chorismate mutase (y2828) from Yersinia pestis pptx

... the forward primer 5¢-GG AATTC CATATGCAACCCACTCATACGCTAACAAG-3¢ (with the NdeI restriction recognition sequence underlined) and the reverse primer 5¢-CG GGATCCTTATTTTAATT TTACCTGATTGAAGGTTGAG-3¢ ... recognition sequences for cloning into pG58 was: 5 ¢-GCTACG TTTAAAGCGATGATGAGACCAGAACCCCCACATCA CG-3¢ (forward primer with DraI site underlined) and 5¢-CG GAATTCTTAGTGACCGAGGCGGCCCCTGCC-3¢ (reverse primer ... K m of 500 ± 50 lm at 37 °C and pH 7.5. The 2.1 A ˚ X-ray structure shows that *YpCM is an all a- helical protein, and functions as a homodimer, and that each protomer has an independent catalytic

Ngày tải lên: 17/03/2014, 17:20

12 515 0
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf

... Pa1 Pa2 Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2 ... 1269–1272 Tanaka H, Yamamoto T, Shibuya Y, Nishino N, Tanase S, Miyauchi Y & Kambara T (1992) Activation of human plasma prekallikrein by Pseudomonas aeruginosa elastase II Kinetic analysis and identification ... metallo-endoprotease of Serratia marcescens (serralysin), are the alkaline proteinase of Pseudomonas aeruginosa, the ZapA metalloprotease of Proteus mirabilis and proetases A, B, C, G and W of

Ngày tải lên: 23/03/2014, 09:20

11 429 0
Tuberculosis in Liver Transplant Recipients: A Systematic Review and Meta-Analysis of Individual Patient Data doc

Tuberculosis in Liver Transplant Recipients: A Systematic Review and Meta-Analysis of Individual Patient Data doc

... Zhang DY Intracranial tuberculoma in a liver transplant patient: first reported case and review of the literature Am J Transplant 2003;3:88-93 Al-Moamary MS, Al-Baz S, Alothman A, Memish Z, AlJahdali ... Niiya T, Kaneko J, Makuuchi M Resection of a pulmonary lesion after liver transplantation: report of a case Surg Today 2005;35:976-978 Alothman A, Al Abdulkareem A, Al Hemsi B, Issa S, Al Sarraj ... 899 TABLE Predictors of Mortality (Univariate Analysis) MTB Mortality‡ Overall Mortality Characteristics Patient characteristics Mean age (years) Male (%) Transplant center (%) US or Canadian European

Ngày tải lên: 29/03/2014, 03:20

13 531 0
Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

Báo cáo khoa học: Proteome analysis of a rat liver nuclear insoluble protein fraction and localization of a novel protein, ISP36, to compartments in the interchromatin space pptx

... that associates with nuclear matrix DNA Cell Biol 17, 849–858 Lee JY, Nakane Y, Koshikawa N, Nakayama K, Hayashi M & Takenaga K (2000) Characterization of a zinc finger protein ZAN75: nuclear ... Thanumalayan S, Muralikrishna B, Rangaraj N, Karande AA & Parnaik VK (1999) Colocalization of intranuclear lamin foci with RNA splicing factors J Cell Sci 112, 4651–4661 11 Gueth-Hallonet C, Wang ... 145 mm NaCl Animals Animal care, housing and killing were in accordance with the guidelines of the Ministry of Education, Science, Sports and Culture of Japan for the use of laboratory animals Cell

Ngày tải lên: 30/03/2014, 20:20

12 401 0
Báo cáo Y học: Conformational analysis by CD and NMR spectroscopy of a peptide encompassing the amphipathic domain of YopD from Yersinia potx

Báo cáo Y học: Conformational analysis by CD and NMR spectroscopy of a peptide encompassing the amphipathic domain of YopD from Yersinia potx

... combination of plcrH10: 5¢-CGAGGTACATATGCAACAAGAGACG-3¢ and plcrH11: 5¢-ACGTACAGATCTCCTTGTCGTCGTCGT CTGGGTTATCAACGCACTC-3¢.Thisfragmentwas then cloned into the expression vector pET3 0a (Novagen, Wisconsin, ... Structural restraints, rmsd values and the results from Ramachandran plot analysis are summarized in Table 1. Fig. 7. Distribution of distance restraints and rmsd values for YopD 278)300 . (A) Distribution ... Conformational analysis by CD and NMR spectroscopy of a peptide encompassing the amphipathic domain of YopD from Yersinia Tobias Tengel 1 , Ingmar Sethson 1 and Matthew S. Francis 2 1 Departments of

Ngày tải lên: 31/03/2014, 21:21

10 449 0
Analysis and practical implementation of a model for combined growth and metabolite production of lactic acid bacteria

Analysis and practical implementation of a model for combined growth and metabolite production of lactic acid bacteria

... rate and the specific production rate to [LaH] and pH, the accuracy of latter input values is also of major im- portance. Therefore, an adequate calculation method for the actual values of [LaH] ... pounds, and (ii) inhibition of the outgrowth of microbial pathogens and spoilage organisms. The antimicrobial potential of LAB together with their status as Generally Regarded As Save (GRAS) organisms ... theoret- ical analysis of the model. Some mathematical proper- ties of the model are discussed, and an easy-to-use method to take into account the evolution of pH and undissociated lactic acid [LaH]

Ngày tải lên: 05/05/2014, 08:44

12 625 0
báo cáo hóa học: " Improvement of quality of life, anxiety and depression after surgery in patients with stress urinary incontinence: Results of a longitudinal short-term follow-up" docx

báo cáo hóa học: " Improvement of quality of life, anxiety and depression after surgery in patients with stress urinary incontinence: Results of a longitudinal short-term follow-up" docx

... scales and the FACT-G scales are concordant since decreased social withdrawal and avoidance, reduced psychosocial impact and less embarrassment are accompanied by better emotional and functional ... that they had to plan every detail in advance because of their UI and that they were afraid of physical activities, because of the association between involuntary loss of urine and physical strain ... weeks Assessment Figure Changes2in anxiety and depression (HADS) Changes in anxiety and depression (HADS) Avoidance, Psychosocial-Impact, Social Embarrassment and Total-Score (see Table 2, Table and

Ngày tải lên: 18/06/2014, 19:20

11 457 0
báo cáo hóa học:" The psychological context of quality of life: a psychometric analysis of a novel idiographic measure of bladder cancer patients’ personal goals and concerns prior to surgery" pot

báo cáo hóa học:" The psychological context of quality of life: a psychometric analysis of a novel idiographic measure of bladder cancer patients’ personal goals and concerns prior to surgery" pot

... religious participation and affiliation, disease and treatment history, and co-morbidities Analysis Plan Our analysis included examination of patient characteristics and quality of life, thematic content ... Quality of Life Appraisal Profile was associated with measures of motivation, goal content and progress, as well as relationships with demographic and standard quality of life measures This measure ... as adaptation to stomata, incorporation of lifestyle, activity or dietary changes, and stress and anxiety associated with watchful waiting [9,10,2,11] Such rating scales are widely accepted and

Ngày tải lên: 20/06/2014, 15:20

18 583 0
Báo cáo hóa học: " Bifurcation analysis of a diffusive model of pioneer and climax species interaction" pot

Báo cáo hóa học: " Bifurcation analysis of a diffusive model of pioneer and climax species interaction" pot

... > 0, and u, v represent a measure of a pioneer and a climax species, respectively f(z), the growth rate of the pioneer population, is generally assumed to be smoothly deceasing, and has a unique ... http://www.advancesindifferenceequations.com/content/2011/1/52 Page of 11 be the inner dot and a = b∗ = 1, b= iω + d1 μ1 − a1 1 , a1 2 a? ?? = −iω + d2 μ1 − a2 2 , a1 2 M= πω ia12 Express the partial derivatives of f(u, v) and g(u, v) at (u, v) = (0, ... Liu and Wei Advances in Difference Equations 2011, 2011:52 http://www.advancesindifferenceequations.com/content/2011/1/52 RESEARCH Open Access Bifurcation analysis of a diffusive model of pioneer

Ngày tải lên: 20/06/2014, 22:20

11 280 0
Báo cáo hóa học: "Existence of solutions and convergence analysis for a system of quasivariational inclusions in Banach spaces" pptx

Báo cáo hóa học: "Existence of solutions and convergence analysis for a system of quasivariational inclusions in Banach spaces" pptx

... Chen and Wan Journal of Inequalities and Applications 2011, 2011:49 http://www.journalofinequalitiesandapplications.com/content/2011/1/49 Page 2 of 14 E and t Î [0, +∞), and J q is single-valued ... of 14 Chen and Wan Journal of Inequalities and Applications 2011, 2011:49 http://www.journalofinequalitiesandapplications.com/content/2011/1/49 17 Wangkeeree, R, Kamraksa, U: An iterative ... smooth Banach space, and A 1 , A 2 , M 1 and M 2 be the same as in Theorem 3.4, and let T be a -Lipschitz continuous mapping. Assume that Ω ∩ F(T) ≠ ∅, {a n } and {b n } are sequences in [0, 1] and

Ngày tải lên: 21/06/2014, 00:20

14 396 0
Identification, characterization and expression analysis of a novel TPA (12 0 tetradecanoylphorbol 13 acetate) induced gene

Identification, characterization and expression analysis of a novel TPA (12 0 tetradecanoylphorbol 13 acetate) induced gene

... (20-22) A molecular and pathological analysis of evolving pancreatic adenocarcinoma has revealed a characteristic pattern of genetic lesions The challenge now is to understand how these signature ... that the activation of telomerase is a late event (58-60) BRCA2 Inherited BRCA2 mutations are typically associated with familial breast and ovarian cancer syndrome, but also carry a significant ... differentiation and proliferation Other growth factors such IGF-I and PDGF play a role in pancreatic development (1-5) 1.1.2 Cancer of the Pancreas The vast majority of cases of pancreatic cancer are adenocarcinomas...

Ngày tải lên: 14/09/2015, 22:09

118 504 0
w