... (a) in the F1 hybrids (Aa) segregated into traits (A) and (a) during formation of the male pollen (sperm) cells and also during formation of the female ger- minal cells (ova). Thus, each pollen ... diagrammatic explanation for the formation of the F2 population of plants produced by self-fertilisation of his F1 hybridsFigure 1 Mendel's diagrammatic explanation for the formation of the F2 ... implausible formulation (Aa) for a hybrid by a plausible formulation, we face the prospect of abandoning the rest of Mendel's arguments. That is not to say that we abandon admiration for Men-...
Ngày tải lên: 13/08/2014, 22:22
... implications for surface- and bottom-water conditions during sapropel deposition since MIS Ekrem Bursin İŞLER, Ali Engin AKSU*, Richard Nicholas HISCOTT Department of Earth Sciences, Centre for Earth ... subsample of ~7 cm3 for organic geochemical/stable-isotope analyses, and a subsample of ~13 cm3 for inorganic stable-isotope analyses and planktonic foraminiferal studies For oxygen isotopic analyses, ... foraminifera Globigerinoides ruber and the benthic foraminifera Uvigerina mediterranea were used For a few samples, where G ruber was absent, Globigerina bulloides was picked instead For planktonic...
Ngày tải lên: 13/01/2020, 19:57
(TIỂU LUẬN) several difficulties have arisen for amazon during the COVID 19 epidemic since limitations have harmed and interrupted company operations
... (school/hospital), and exports outside of the country are next Information Flow Utilizing sophisticated information platforms that support effective information exchange across supply chain participants and ... storage and distribution are outsourced by Amazon for items that aren't regularly purchased or requested for quick delivery, as well as for items for which the storage costs outweigh the marginal ... inventory (Plex 2020) Therefore, push inventory management is strongly dependent on longterm forecasts and customer demand estimation, especially the adoption of a demand forecast that drives the...
Ngày tải lên: 05/12/2022, 06:36
Tài liệu Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during Spring of 2007 ppt
... Virginia: 2008 For product and ordering information: World Wide Web: http://www.usgs.gov/pubprod Telephone: 1-888-ASK-USGS For more information on the USGS the Federal source for science about ... North Fork of the Shenandoah River, Virginia Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during ... the North Fork of the Shenandoah River Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during Spring...
Ngày tải lên: 14/02/2014, 08:20
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc
... during the first 24 h of cold exposure (Fig 7A,B, CO2 to sucrose) A similar pattern was observed for rates of CO2 uptake and export of sucrose to sink organs, but not for starch synthesis As already ... electrode For starch extraction, pellets for ethanol extraction were solubilized by heating them to 95 °C in 0.5 m NaOH for 30 After acidification with m CH3COOH, the suspension was digested for h ... obtain timecontinuous information on net photosynthesis during the whole period of cold exposure The rate of raffinose synthesis, rSuc fi Raf, was calculated as already described for starch, assuming...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... GACTACTTTGGAGTTTGCGGTCAC B1R 3’-RACE 6 both forward AGTTGGGCATTCATCCATCC F13R 7 both forward CAGAAAAAGACAAGGAGGAC F19R Isoform-specific PCR 8 both forward ACAACACCACTGCTGCGGAGTTA J1F 9 short reverse ... LDH-A isoforms, which differ substantially in the coding sequence and length of the 3¢-UTR. Therefore, iso- form-specific PCR was carried out. RT-PCR and sequence determination were performed as ... diploid (2n ¼ 50) or tetraploid species (2n ¼ 100) [25], for example, populations of M. fossilis from Eastern Europe [26]. Therefore, we performed karyo- typic analysis of gill tissue from experimental...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo Y học: Phosphorylation of initiation factor-2a is required for activation of internal translation initiation during cell differentiation ppt
... G. Krause for the antibody against phosphorylated eIF2a, D. Canaani for antibody against CKIIa, N. Sonenberg for PKRD6 construct, R. J. Kaufman for eIF2a-S51A construct, and B Z. Levi for the pSKVLUC ... reduced during differentiation, correlating with increased eIF2a phosphorylation that is known to be important for cap-dependent translational control; and (c) inhibition of eIF2a phosphorylation during ... The membrane was then used for Western analysis using antibodies specific for Ser51-phosphorylated eIF2a (Research Genetics, Inc.), and following stripping mAb specific for total eIF2a were used. Polysome...
Ngày tải lên: 22/02/2014, 07:20
NUTRIENT ADEQUACY OF EXCLUSIVE BREASTFEEDING FOR THE TERM INFANT DURING THE FIRST SIX MONTHS OF LIFE potx
... NUTRITION FOR HEALTH AND DEVELOPMENT DEPARTMENT OF CHILD AND ADOLESCENT HEALTH AND DEVELOPMENT WORLD HEALTH ORGANIZATION NUTRIENT ADEQUACY OF EXCLUSIVE BREASTFEEDING FOR THE TERM INFANT DURING THE ... health care, and health promotion for individuals and communities. Progress towards better health for all also demands the global dissemination and exchange of information that draws on the knowledge ... fax: +41 22 791 4857; email: bookorders@who.int). Requests for permission to reproduce or translate WHO publications – whether for sale or for non- commercial distribution – should be addressed to...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo khoa học: A mammalian monothiol glutaredoxin, Grx3, is critical for cell cycle progression during embryogenesis doc
... counted for Grx3+ ⁄ + and 527 cells counted for Grx3) ⁄ ) The bars represent means ± SD Student’s t-test *P < 0.0001 (F,G) Grx3+ ⁄ + and Grx3 ) ⁄ ) MEFs were pulse-labeled with BrdU for h before ... gene-specific primers For ScGrx3, we used the forward primer 5¢-GGCTCTAGAATGTGTTCTTTTCAG GTTCCAT-3¢ and the reverse primer 5¢-CCGGAGCTCTT AAGATTGGAGAGCATGCTG-3¢ For ScGrx4, the we used the forward primer ... primers For HsGrx3, the we used forward primer 5¢-GCCGGATCCATGGCGGCGGGGG CGGCTGAGGCA-3¢ and the reverse primer 5¢-GGCGT CGACCCGCGGTTAATTTTCTCCTCTCAGTAT-3¢; and for MmGrx3, we used the forward...
Ngày tải lên: 14/03/2014, 23:20
Guidelines for Use of Personal Protective Equipment by Law Enforcement Personnel During A Terrorist Chemical Agent Incident potx
... fundamental information that is required to help those responsible for acquisition make sound decisions Additional information regarding law enforcement activities and recommendations for responding ... Comparison Table Considerations for Using Tactical Officers to Perform Operations Inside of the Warm Zone Overall PPDFs for Patrol Suit Ensembles Overall PPDFs for SWAT Protective Ensembles Physiological ... GUIDELINES FOR MASS USE OF PERSONAL PROTECTIVE EQUIPMENT BY LAW ENFORCEMENT PERSONNEL DURING A TERRORIST CHEMICAL AGENT INCIDENT 1.0 INTRODUCTION AND BACKGROUND The challenges facing law enforcement...
Ngày tải lên: 17/03/2014, 14:20
The Relationship Between Bank and Interbank Interest Rates during the Financial Crisis: Empirical Results for the Euro Area pptx
... retail bank interest rates in the Euro area during the financial crisis. Empirical results, based on monthly data for the period 2003(1)-2011(9), show that during periods of financial turmoil all ... of 2009, most significantly for the operations of shorter duration, and slowly began to rise again since the mid-2010. So we can se that there has been, and it is still occurring, an impediment ... losses during the crisis are the same ones that had the greatest difficulty in raising funds on the interbank markets, and that suffer the most pressure from the market for improving their performance....
Ngày tải lên: 22/03/2014, 23:20
Báo cáo khoa học: The predominant protein arginine methyltransferase PRMT1 is critical for zebrafish convergence and extension during gastrulation pdf
... methyltransferase 1 isoforms with distinct activity, substrate specificity, and subcellular localization... Chuang for fish rearing, cDNA preparation and WISH probe preparation References 1 Bedford MT & ... cells were allowed to attach for 10 h, well inserts were removed, and the cells were allowed to migrate into the clear field for 16 h Cells were fixed with formaldehyde, stained with crystal ... Chuang for fish rearing,... to our authors and readers, this journal provides supporting information supplied by the authors Such materials are peer-reviewed and may be re-organized for ...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: Identification of alternative promoter usage for the matrix Gla protein gene Evidence for differential expression during early development in Xenopus laevis doc
... evidence for differential promoter usage in vivo. These findings indicate that transcription of the larger IA form is important for gastrulation, whereas the shorter IB form is likely to play a role during ... car- tilage formation and mineralization. In conclusion, our data identifies for the first time, the presence of alternative promoter usage for the MGP gene and provides clear evidence for differential expression ... localization of the exon-specific oligonucleotide primers used for PCR amplification. a + c for amplification of the larger IA transcript; b + c for amplification of the shorter IB transcript. (B) PCR amplification...
Ngày tải lên: 30/03/2014, 16:20
Playing for Their Nation Baseball and the American Military during World War II pptx
... maintained a prominent place in their lives both before and during the war During the 1944 invasion of Tulagi in the Solomon Islands, for example, Marine sergeant Dana Babcock witnessed ... aggression of totalitarian governments baseball went along for the long and arduous ride introduction xiii Playing for Their Nation Chapter 1 Vitalizing Spirit Baseball in ... campaign.3 Military commanders therefore deemed it essential to increase the level of morale both on and off the battlefield to ensure the optimal performance of the American fighting...
Ngày tải lên: 31/03/2014, 10:21
Generic assessment procedures for determining protective actions during a reactor accident IAEA
... phases of the emergency before, during and after a release of radioactive material. It is intended for use by on-site and off-site groups responsible for evaluating the accident ... general sequence they should be performed, but it is possible to perform steps out of sequence. Therefore, read each procedure completely before applying it. (f) The procedures ... levels for urgent protective actions 120 Table F3 IAEA generic intervention levels for temporary relocation and permanent resettlement 121 Table F4 Shielding factors for ...
Ngày tải lên: 18/05/2014, 19:25
Báo cáo hóa học: " Abstract Despite new additions to the standard of care therapy for high grade primary malignant brain tumors, the prognosis for patients with this disease is still poor." ppt
... care therapy for high grade primary malignant brain tumors, the prog- nosis for patients with this disease is still poor. A small contingent of clinical researchers are focusing their efforts on ... pulsed with mRNA for the CC chemokine receptor 7(CCR7)inanefforttodirecttheCMV-specificDCto the lymph nodes. Upon recurrence, biopsies will be eval- uated for DC or CTL infiltrates, and for pp65-antigen ... individual trials. The patient populations treated must be segregated into uni- form groups for data analysis. For valid statistical con- clusions to be reached one cannot directly compare the...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " Development of a mathematical model for predicting electrically elicited quadriceps femoris muscle forces during isovelocity knee joint motion" potx
... stimulation patterns for optimiz- ing force production during FES are probably complex. One way to assist the search for the optimal pattern is to use mathematical models that can predict forces accu- ... muscle force due to stimulation, F, it is necessary to add M cos θ to F EXT , the force measured by the Kin-Com force transducer. This was done during data analysis (see Experimental procedure for ... 50 ms for the CFT, 50 ms for the VFT, and 70 ms for the DFT The coefficients of determination between the measured and predicted forces showed that the model accounted for ~86%...
Ngày tải lên: 19/06/2014, 08:20
Human resource management and performance still searching for some answers
... HRM leads to performance, but this link ceases to be significant when we control for past performance. Invariably, past performance is much the strongest predictor of current performance and this ... et al ., 2000 ). But is also leaves room for considerable doubt about the processes at play. We therefore need to recognise the need for more careful formulation of research and perhaps less ... appropriateness for the research context is questionable. It would be unfortunate if this deterred some good researchers, including qualitative researchers, from entering the field since there are still...
Ngày tải lên: 20/07/2014, 00:30
Báo cáo lâm nghiệp: "Whole tree hydraulic conductance and water loss regulation in Quercus during drought: evidence for stomatal control of embolism?" doc
... water loss regulation in Quercus during drought: evidence for stomatal control of embolism? H Cochard, N Bréda, A Granier Unité d’écophysiologie forestière, Centre de Nancy, Inra, ... remained unchanged for the control tree and that the maximum flow densities were comparable for the dif- ferent days. The maximum transpiration rate was therefore not limited ... readers can refer to the papers just mentioned for more details. The predawn and midday leaf water potentials declined progressively during the drought development. Water potentials...
Ngày tải lên: 08/08/2014, 18:21
Báo cáo y học: " Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune disease" pot
... (TCR) alone provides insufficient signals for optimal T cell stimulation. A second co- stimulatory signal for optimal T cell stimulation is needed. Critical for the generation and control of functional ... are the key receptors for this regulation via positive and negative costimulation [2]. These receptors and their pathways therefore provide promising therapeutic targets for modulating immune ... surface early after the Review Multiple functions for CD28 and cytotoxic T lymphocyte antigen-4 during different phases of T cell responses: implications for arthritis and autoimmune diseases Monika...
Ngày tải lên: 09/08/2014, 01:23