... phenol và alkyl phenols, halogenated phenols, nitrophenols, alkanes, halogenated aliphatics, alcohols, halogenated alcohols, aldehydes, etes, xetons, acrylates, các axit carboxylic, các axit amine, ... Indol, Scatol, Mecaptan… được sinh ra và pH của môi trường tăng dần lên Giai đoạn acetat hóa (Acetogenesis): Vi khuẩn acetic chuyển hóa các sản phẩm của giai đoạn acid hóa thành acetate, H2, ... Extracell polymeric substances) SRB Vi khuẩn loại bỏ sulfate (sulfate reducing bacteria-SRB) TAN Tổng N-NH3 (total ammonia nitrogen-TAN) VFAs Các axit béo có khả nang bay hơi (volatile fatty acids-VFAs)
Ngày tải lên: 09/04/2019, 17:04
... actual input data and parameter values are unified with the respective input and parametric variables of the embedded local program Next, the local program calculates the prescribed output data ... for testing of an example fish tank model As a comprehensive data set for testing of the model, we utilized the available empirical data and equations for African catfish (Clarias gariepinus) ... journal.magisz.org Testing of Direct Computer Mapping for dynamic simulation of a simplified Recirculating Aquaculture System Mónika Varga1, Sándor Balogh2, Balázs Kucska3, Yaoguang Wei4, Daoliang
Ngày tải lên: 27/09/2019, 10:31
Analysis and Simulation of a Fair Queueing Algorithm
... to, anti-social behavior On the surface, this proposal appears to have considerable merit, but we are not aware of any published data on the performance of datagram net-works with such fair queueing ... allocation of packets-sent but fails to guarantee a fair allocation of bandwidth because of variations in packet sizes To see how this unfairness can be avoided, we first consider a hypothetical ... fairness, and we have demonstrated that our algorithm achieves those goals However, we have not been able to characterize the promptness allocation for an arbitrary arrival stream of packets To obtain
Ngày tải lên: 19/10/2022, 03:02
Large eddy simulation of a buoyancy-aided flow in a non-uniform channel – Buoyancy effects on large flow structures
... Trang 1Large eddy simulation of a buoyancy-aided flow in a non-uniformchannel – Buoyancy effects on large flow structures Y Duana,b, S Hea,⇑ a Department of Mechanical Engineering, University of ... Merzari and Ninokata (2009), Abbasian et al A research group in Tokyo Institute of Technology has also con-ducted a series of work on this topic Their work can be found in Baglietto and Ninokata ... in Case 4 is the same as that at ‘MP1’ It is reasonable to infer that the structures in the nar-row gap and wide gap are strongly correlated in Case 4 The fpof PSDX at ‘MP1’ and ‘MD’ in all cases
Ngày tải lên: 24/12/2022, 00:53
Luận Văn Design And Simulation Of A Single-Hinge And Adaptive Ankle Foot Orthoses Based On Superelasticity Of Shape Memory Alloys.pdf
... Graduate Faculty as partial fulfillment of the requirements for the Master of Science Degree in Mechanical Engineering Trang 3An Abstract of Design and Simulation of a Single-Hinge and Adaptive Ankle ... superelastic characteristics of shape memory alloy Simulation of the SMA hinge in both sagittal plane of motion and frontal/transverse planes by evaluating the behavior of the element in satisfying ... sagittal plane, a Finite Element Analysis (FEA) is developed for the proposed design of the passive SMA AFO Lateral loading response is also evaluated by corresponding multi-axial loading simulation
Ngày tải lên: 19/06/2023, 09:43
DESIGN AND SIMULATION OF A THREE-DEGREES-OF- FREEDOM WELDING ROBOT ALONG A STRAIGHT SEAM
... Trang 11 PHENIKAA UNIVERSITY FACULTY OF MECHANICAL ENGINEERING AND MECHATRONICS PROJECT OF MECHATRONICS SYSTEM DESIGN DESIGN AND SIMULATION OF A FREEDOM WELDING ROBOT ALONG A STRAIGHT SEAM ... learn to calculate and simulate a typical mechatronic system Due to limited time and knowledge limitations, students only deal with some basic problems in designing a robot There are also many ... and quality to be improved thanks to modern machinery lines replacing manual labor The contents of the project help students consolidate and review the knowledge they have learned, as well as
Ngày tải lên: 07/03/2024, 14:05
WELDING SIMULATION OF A GEAR WHEEL USING FEM
... weld and is where all material has peak temperatures above melting temperature and consists of both filler and parent material The heat-affected zone (HAZ) consists of parent material only and ... Mechanics Trang 3MASTER’S THESIS IN APPLIED MECHANICS Welding Simulation of a Gear Wheel Using FEM ANDREAS ROBERTSSON JERK SVEDMAN Department of Applied Mechanics Division ofMaterial and Computational ... Trang 1Welding Simulation of a Gear Wheel Using FEM Master’s Thesis in Applied Mechanics ANDREAS ROBERTSSON JERK SVEDMAN Department of Applied Mechanics Division of Material and Computational
Ngày tải lên: 22/04/2024, 15:44
Estimation of gas composition and char conversion in a fluidized bed biomass gasifier
... heights, m madd,b mass of additive/inert in the reactor, kg mc,p mass of carbon in a char particle, kg mc,b mass of carbon in the reactor, kg mch,b mass of char (carbon and fuel ash) in the reactor, ... catalysts are rarely used as bed material Mineral catalysts (dolomite, calcite, magnetite, oliv-ine, etc.) are conventional bed materials, but their catalytic activity on WGSR (and also on tar ... total mass of bed material (inert/additive and char) in the reactor is mT,b= mch,b+ madd,b The char load at steady state depends on the char reactivity and the residence time of the char particles
Ngày tải lên: 29/07/2016, 15:39
FischerTropsch liquid fuel production by cogasification of coal and biomass in a solar hybrid dual fluidized bed gasifier
... the gasification reactor (GR) The temperature and flow rate of the bed material are maintained constant to achieve steady operation of the gasification reactor and downstream process The warm and ... production by co-gasification of coal and biomass in a solar hybrid dual fluidized bed gasifier P Guoa,c, W Sawa,c, P van Eyka,c, P Ashmana,c,*, G Nathanb,c and E Stecheld a Schools of Chemical Engineering, ... rate of bed material to the gasification reactor (Qnet,sol,full)ann(peak) is the value of Qnet,sol,full when the solar insolation reaches the annually peak value To evaluate the annually averaged
Ngày tải lên: 01/08/2016, 09:30
CFD DEM simulations of a fluidized bed crystallizer
... crystals For the validation experiments mea-in Setup 2, 100 000 particles are mea-injected mea-in reality, and this number is retamea-ined mea-in the CFD-DEM simulations, as well All further parameters ... function Q 3 of the asparagine crystals in Setup 1. 3 Validation of the CFD-DEM Simulation Model Trang 19Figure 7: Left: Model crystallizer column for validation; right: target for camera calibration.The ... can be drawn The good news is that parallelization can be used tonoticeably speed-up the simulation process; using 64 instead of 8 processors can reduce the simu-lation time by a factor of almost
Ngày tải lên: 19/11/2022, 11:43
modelling simulation and optimization of industrial fixed bed catalytic reactors topics in chemical engineering
... modelling, simulation and optimization of industrial fixed bed catalytic reactors, The book can be used for advanced academic courses on industrial fixed bed catalytic reactors as well as for advanced ... typing of the manuscript S S E H Elnashaie and S S Elshishini Trang 8Notation ae Cell surface area (m*) volume half ratio Ay Area of heat transfer (m?) A, Cross-sectional area of slab catalyst ... BED CATALYTIC REACTORS Fixed bed catalytic reactors have a wide variety of configurations ranging from the single bed adiabatic configuration to the multi- tubular, non adiabatic configurations
Ngày tải lên: 02/04/2014, 15:50
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Hemalatha Balaram2and Padmanabhan Balaram1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific ... examining the consequence of muta-tions that may affect substrate binding and catalysis Using a database of 380 unique TIM sequences from non-archaeal sources, we have examined the nature of ... dra-matically reduced activity The role of dimer interface residues in the stability and activity of the Plasmodium falciparum enzyme, PfTIM, has been probed by analysis of mutational effects at
Ngày tải lên: 18/02/2014, 11:20
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... R15A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R15A reverse (5¢-GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H447A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... H447A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T462A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T462A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); ... lanes 2,7, mutant R15A; lanes 3,8, mutant H447A; lanes 4,9, double mutant H447A, D450A; lanes 5,10 mutant T462A. Trang 8reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAATAGCATCCAAAATGACTTGC-3¢) All mutations
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx
... Trang 1a single amino acid catalytic center?Supporting amino acid residues at the active site of penicillin G acylase Diana Zhiryakova1, Ivaylo Ivanov2, Sonya Ilieva3, Maya Guncheva1, Boris Galunsky4and ... member of the Ntn (N terminal nucleophile) hydro-lase family Croatica Chim Acta 73, 901–908 3 Perakyla M & Kollman PA (1997) A simulation of the catalytic mechanism of aspartylglucosaminidase ... 25 Yamagami C, Takao N, Tanaka M, Horisaka K, Asada S & Fujita T (1984) A quantitative structure–activity study of anticonvulsant phenylacetanilides Chem Pharm Bull 32, 5003–5009 26 Birnbaum
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Directed evolution of a histone acetyltransferase – enhancing thermostability, whilst maintaining catalytic activity and substrate specificity doc
... catalytic domain of the human HAT P⁄ CAF, with-out affecting its catalytic activity or substrate specific-ity P⁄ CAF, p300 ⁄ CBP-associating factor, is a trans criptional coactivator with a variable N-terminal, ... Continuous HAT assay Progress curves as a measure of HAT activity of wild-type and mutant P⁄ CAFs were followed using a coupled enzyme assay [62] HAT activity generates CoA as a byproduct that is converted ... CAF mutants have a strongly enhanced resistance towards thermal inactivation Catalytic properties and specificity of the P/CAF enzymes The kinetic parameters of the wild-type and mutant P⁄ CAF
Ngày tải lên: 23/03/2014, 06:20
Two dimensional numerical computation of a circulating fluidized bed biomass gasifier
... was divided into three stages including biomass pyrolysis, char–gas reactions, and gas-phase reaction At each stage, an empirical equation was estimated from experimental data to calculate carbon ... rate and particle size, biomass properties, air ratio, steam to biomass ratio, air to biomass ratio, and the superficial velocity The simulation model calculates the axial and radial profiles of ... 4258–4272 Ramzan, N., Ashraf, A. , Naveed, S., & Malik, A (2011) Simulation of hybrid biomass gasification using Aspen plus: A comparative performance analysis for food, municipal solid and poultry waste...
Ngày tải lên: 01/08/2016, 09:30
Báo cáo vật lý: "Mixing Behavior of Binary Polymer Particles in Bubbling Fluidized Bed" doc
... number of sample number of particles in each sample fraction of the key component in a binary mixture pressure drop across the bed gas flow rare estimate of standard deviation of sample estimate of ... mixture as a measure of the quality of the mixture Thus a low standard deviation indicates a narrow spread in composition of samples and therefore predicts a good mixing The sample variance, S2 ... Letters ρba ρg ρp cross-sectional area of column the arithmetic mean of adjacent sieve size (particle size) mean sieve particle size m2 µm µm diameter of sphere having same volume as a particle...
Ngày tải lên: 07/08/2014, 14:20
Study on the fate of metal elements from biomass in a benchscale fluidized bed gasifier
... Furusawa T, Kuchonthara P, et al Release behavior of tar and alkali and alkaline earth metals during biomass steam gasification Energy Fuels 2008;22(6):4235–9 [17] Sasaoka E, Hirano S, Kasaoka S, ... Leucaena leucocephala and sugarcane bagasse, fiber derived from Saccharum of cinarum, were gasified in a steam atmosphere using a bench-scale fluidized bed reactor The fate of trace elements (Ba, ... samples were subjected to elemental analysis using ICP–AES 2.5 Approach for elemental mass balance The input and output flow rate data can be used together to calculate a mass balance in a reactor...
Ngày tải lên: 29/07/2016, 14:03
Simulation of a Multiple Input Multiple Output (MIMO) wireless system
... described as travelling along localized ray paths (i.e approximately a straight line) Therefore, ray tracing can be used as a method for the simulation and approximation of radio wave propagation ... the appropriate electric field value The ray list contains all of the data about rays propagating from a base station to a field point Each field point has a ray list associated with it A ray ... Fitzpatrick As can be seen, it is passed a particular base station, an image and its order, and also the field point As seen earlier a ray is made up of nodes, two of these nodes are always the base...
Ngày tải lên: 20/11/2012, 11:36
Design and Simulation of A CMOS-MEMS Accelerometer
... ratio of parasitic capacitance and sensing capacitance can be measured, and the estimated value is calculated assuming a total sensing capacitance of 60fF Parasitic capacitance and mismatch of ... capacitors, Cd is about an order of magnitude larger than Cd_air, so approximately the total gap capacitance is equal to the sum of Cm_air and Cd_air, which is close to the gap capacitance of ... folded-cascode amplifier has good stability and reasonable gain with a single gain stage Hspice simulation shows a dc gain of 2800, with a open-loop -3dB bandwidth of 60kHz for a 2pF load capacitor A...
Ngày tải lên: 27/10/2013, 23:15