showing text and a value in a cell

... ACGGAGAUUAGUUUC3’, and 5’GAUGAUAGAAAC UGUAAGU3’ for FABP7, 5’UCGGAGGCGUGACCUAU GA3’, 5’CCUCAGAGAUCGUGGGUGA3’, 5’GUGAGAA GAAUUAUGAUGA3’, and 5’GCAAGGAAAGCAACAU ACA3’ for FABP6 The final concentration of siRNA ... Trang 1R E S E A R C H A R T I C L E Open AccessFatty acid binding protein 7 may be a marker and therapeutic targets in clear cell renal cell carcinoma Kazuhiro Nagao1,2*, Nachi Shinohara1, Frank ... was used to transfect SKRC7 and SKRC10 cells according to the manufacturer’s instructions The se-quences of the siRNAs were 5’CAACGGUAAUUAUC AGUCA3’, 5’GUCAGAACUUUGAUGAGUA3’, 5’GAAC ACGGAGAUUAGUUUC3’,

Ngày tải lên: 03/07/2020, 00:57

... Breast invasive carcinoma (BRCA), Colon adenocarcinoma (COAD), Rectum adenocarcinoma (READ) Head and Neck Squamous Cell Carcinoma (HNSC), Prostate adenocarcinoma (PRAD), Ovarian serous cystadenocarcinoma ... urothelial car-cinoma (BLCA), glioblastoma multiforme (GMB), brain lower grade glioma (LGG), breast invasive carcinoma (BRCA), colon adenocarcinoma (COAD), rectum ade-nocarcinoma (READ), head and ... found in both LUAD and LUSC, genes involved in extracellular matrix (ECM) interactions such as collagen type I, V, VI, X; integrin, alpha 8, 11; and fibronectin type III domain containing 1 are

Ngày tải lên: 05/11/2020, 01:23

... CAG tca gtc acg atg cgg-3’ Trang 31pT-Rex-DEST30-intein/EGFP 5’-GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG GCT ATC TCT GGC GAT AGT-3’ 5’-GGGG AC CAC TTT GTA CAA GAA AGC TGG ... Alanine inteins, where alanine is the N-terminal amino acid) Protein splicing is an intramolecular process, involving bond rearrangement rather than bond cleavage and resynthesis and is catalyzed ... work 1.1 Inteins and protein splicing Inteins and their protein splicing abilities are becoming increasing invaluable tools in protein engineering.[1] Protein splicing is a cellular processing event

Ngày tải lên: 08/11/2015, 16:30

... equity-based incentive compensation that exceeds the market level and insider trading Related party transactions may play a role in creating a transaction cost saving and improve the operating efficiency ... MNC, Saratoga, Ciputra, Bakrie and Rajawali In the first layer of market capitalization, Astra business group with 7 companies was chosen Astra was selected because it was the only private business ... using panel data have advantages compared to the cross-sectional or time-series data The advantages of panel data are: (1) panel data generally give researchers a large number of data points,

Ngày tải lên: 01/02/2020, 22:44

... clear cell carcinoma and the remaining 13 specimens were non-clear cell carcinoma (3 papillary carcinoma, 3 chromophobe carcinoma, 3 sarcomatoid car-cinoma, 2 granular carcinoma and 2 collecting ... homeostasis and many diseases including cancer [22] An imbalance between pro-apoptotic and anti-apoptotic factors induces an abnormal pattern of cell death The death-associated protein kinase-1 (DAPK1), ... Fukuhara4, Miho Hiraki1, Naoko Arichi1, Hiroaki Yasumoto1, Hiroshi Hirata2, Soichiro Yamamura2, Varahram Shahryari2, Guoren Deng2, Darryn K Wong2, Shahana Majid2, Hiroaki Shiina1, Rajvir Dahiya2and

Ngày tải lên: 22/09/2020, 22:57

... region at 21q21 in human lung cancers [13], and that miR-99a is downregulated in ovarian carcin-oma [14], squamous cell carcincarcin-oma of the tongue [15], squa-mous cell lung carcinoma [16], hepatocellular ... USA) GAPDH and β-actin (Bioworld, Nanjing, China) on the same mem-brane was used as a loading control The specific pro-tein was detected by a BCA Propro-tein Assay Kit (KeyGen, China) The band ... diverse cellular functions and is inappropriately activated in many human cancers [24,25] MTOR signaling path-way plays a crucial role in the regulation of cell growth, protein translation, metabolism,

Ngày tải lên: 05/11/2020, 07:50

... Ig-like domain and an intracellular split tyrosine domain Upon ligand binding, FGFRs dimerize, resulting in transphosphorylation and activation of downstream signaling cascades After activation, ... 2004 Randomized phase II trial comparing bevacizumab plus carboplatin and paclitaxel with carboplatin and paclitaxel alone in previously untreated locally advanced or metastatic non-small-cell ... Genentech, Inc., South San Francisco, CA 5 XALKORI 2011 XALKORI
(crizotinib) Capsules, oral [package insert] Pfizer Labs, New York 6 Yano, T., A Haro, Y Shikada, R Maruyama, and Y Maehara 2011 Non-small

Ngày tải lên: 02/11/2022, 10:43

... may be a potential target of anticancer therapy Trang 2Nasopharyngeal carcinoma affects predominantly young population in Southeast Asia (Hong et al 2013) The mechanism of nasopharyngeal carcinoma ... the normal nasopharyngeal epithelium) (Zhu et al 2012) Nasopharyngeal carcinoma is a nonlymphomatous and squamous cell neoplasm that occurs in the epithelial lin-ing of the nasopharynx and exhibits ... 49–58 Wei, W I., and J S T Sham 2005 Nasopharyngeal carcinoma Lancet 365:2041–2054 von Weikersthal, S F., M A Barrand, and S B Hladky 1999 Functional and molecular characterization of a volume-sensitive

Ngày tải lên: 02/11/2022, 10:46

... Nasal Washes, Healthy and Influenza Infected B Cell Culture of Primary Basal Cells and Cell Lines B Non-Human Primates (M mulatta) B Non-Human Primates (M fascicularis) B Mouse Nasal and Olfactory ... Maarten van den Berge, Michael von Papen, Jeffrey Whitsett, Ramnik Xavier, Yan Xu, Laure-Emma-nuelle Zaragosi, and Kun Zhang Pascal Barbry, Alexander Misharin, Martijn Nawijn, and Jay Rajagopal serve ... 2016;Channappanavar et al., 2019; Channappanavar and Perlman,2017; Davidson et al., 2015); and other factors such as co-infec-tion, age, gender, and co-morbidities, among others Under-standing the

Ngày tải lên: 10/03/2024, 23:38

... to analyse and evaluate the performance of a planar and a tubular-shaped PEM fuel cell 2.1 Computational domain The full computational domains for the planar and tubular-shaped PEM fuel cell ... procedure of Berning and Djilali [10] was used to account for the magnitude of phase change inside the GDL 2.2.3 Catalyst layers The catalyst layer is treated as a thin interface, where sink and source ... significant roles in fully characterizing a PEM fuel cell Changes in operating conditions and physical parameters affecting its performance are qualitatively much better understood using CFD coding

Ngày tải lên: 05/09/2013, 14:58

... methylated DNA were: 5¢-AAGTAGGCGGAGTATCGAAC-3¢ (sense) and 5¢-GAAAAAACGCGATCCTACTT-3¢ (antisense) Primers for unmethylated DNA were: 5¢-GAAGTAGGTGGAGT ATTGAAT-3¢ (sense) and 5¢-CAAAAAAACACAATCCT ACTT-3¢ ... (sense) and 5¢-CGGTTCAGGTACTCAGT CATCCA-3¢ (antisense) for Bcl-2; and 5¢-ACGGGAGAT GACAATGGAGAAAT-3¢ (sense) and 5¢-CATGGGTAG CAGCTCCTTCTTC-3¢ (antisense) for Apaf-1 Total RNA was extracted from ... comparative analysis of the involvement of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, we revealed that exon 9 played a major role in the induc-tion

Ngày tải lên: 18/02/2014, 18:20

... motif domains and a single KH domain similar to the MASK gene found in Drosophila Drosophila MASK (dMASK) has been implicated in cell survival and may play a role in promoting proliferation and preventing ... of VBARP revealed that thisprotein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and to an unknown protein named PP2500 [7,8] Although ANKHD1 variants have ... protein containing a single ankyrin repeat that interacts with HIV-1 viral protein R (Vpr) and we designated this protein as Vpr-binding ankyrin repeat protein (VBARP) This interaction was further

Ngày tải lên: 07/03/2014, 21:20

... (lane in each panel) The rZP3 and rZP3FLAG bands are indicated by arrowheads in (A) , (B), and (C) The rZP4 band is indicated by an arrow in (A) and (B) The ZP4182)464 band is indicated by an asterisk ... were also recognized by GNA and LCA Molecular mass markers are indicated in kDa on the left of each panel candatus agglutinin (ACA) (data not shown) In contrast, all tested lectins recognized native ... biotin-conjugated lectins were PHA-L4, ACA, and GNA ACA and GNA were purchased from EY Laboratories (San Mateo, CA, USA), and the remaining lectins were from Seikagaku Kogyo For the peroxidase-conjugated...

Ngày tải lên: 07/03/2014, 05:20

... extracellular ligand-binding domain and an intracellular catalytic or enzyme-binding domain The great majority of the receptors are themselves protein kinases or are associated with kinases Binding ... one contains almost the entire extracellular domain and the other contains a short ectodomain stub followed by a transmembrane domain and a long cytoplasmic tail After ligand binding, a change occurs ... Ca2+-sensitive manner, and to that of skeletal muscle type α-actinin in a Ca2+-insensitive manner PI-4,5P2 regulates the F-actingelating activity of α-actinin in vitro, and also activates the protein kinase...

Ngày tải lên: 12/09/2015, 21:10

... 208 and 553 to 582 of the CTMP-7 gene respectively: 5'-GGATCCCGCAGGCCAAAGACAACAATAGT GGTGCCAGTCAAGAGCTGGCACCACTATTGTTG TCTTTGGCCTGtcgtcagctcgtgccgtaag TGAAACTAGTTACCAGATCATAACAACCCTCA AGAGGGTTGTTATGATCTGGTAACTAGTTTCA ... and pGE-Neg (Fig. 5a) At 24 h post-infection, the viral load in control cell supernatants was significantly higher than the intracellular viral load In contrast, the intracellular viral load in ... dropout agar plates lacking leucine, tryptophan, histidine and adenine (QDO) and were cloned and sequenced The β-galactosidase assay was performed to compare the relative strength of interaction...

Ngày tải lên: 12/08/2014, 04:20

... catalase and bovine intestine alkaline phosphatase), phenyl–agarose, lectin-free Sepharose 4B and agarosebound concanavalin A, LCA, RCA, DNase I, ethidium bromide and DNA size markers were all ... 5¢-alternative acetylcholinesterase mRNAs have been identified in mice and three in humans [11,12], and acetylcholinesterase-H, 4520 acetylcholinesterase-T and acetylcholinesterase-R mRNAs starting ... Statistical analysis The results are expressed as mean ± standard deviation Statistical differences in cholinesterase activity between nor- Cholinesterases in renal carcinomas mal and malignant kidney...

Ngày tải lên: 06/03/2014, 22:21

... domains involved in localization A B C D Fig Effects of mutations in Lsm8p on its nuclear localization (A) Lsm8p C-terminal domain mutations (B) Lsm8p N-terminal domain mutations and recombinant ... the former and a higher level of nuclear accumulation for the latter, indicating that in the absence of an N-terminal domain distinct localization is lacking Finally, the Lsm1p Sm domain by itself ... involved in intersubunit and protein–RNA contacts [29,33,34] Crystal structures and cross-linking data have shown that RNA-binding residues in Sm(-like) proteins are located in loop (between b2 and...

Ngày tải lên: 07/03/2014, 02:20

... of the caspases Caspases initiate the apoptotic DNA fragmentation by activating certain nucleases [50] The 116 kDa enzyme PARP is cleaved into a 85 kDa fragment and a 25 kDa fragment in many forms ... cytoskeletal polymers which are present in all eukaryotic cells that play important roles in various cellular processes such as cell signaling, cell motility, organelle transport and maintenance of cell ... monoclonal antibcl2 IgG, mouse monoclonal antia-tubulin IgG, affinity isolated rabbit antic-tubulin IgG, alkaline phosphatase-conjugated antimouse IgG, alkaline phosphatase-conjugated antirabbit...

Ngày tải lên: 30/03/2014, 10:20

... on assets (rA ) and total financial liabilities (FL) and average interest rate on liabilities (rL ) respectively Using NSA and NSL as financial assets and 10 Risk Management and Shareholders’ Value ... earned and paid by the bank, along with a slump in the market value of fixed-rate assets and liabilities.1 Usually such a change also causes a decline in demand liabilities and call loans In effect, ... financing 20 Risk Management and Shareholders’ Value in Banking (and again, if this request is not granted, they may pay back their loans and turn to another bank) In practice, empirical analysis...

Ngày tải lên: 30/03/2014, 15:20

... Fukuda S, KanamoriKatayama M, Kitazume Y, Kawaji H, Kai C, Nakamura M, Konno H, Nakano K, Mottagui-Tabar S, Arner P, Chesi A, Gustincich S, Persichetti F, et al: Genome-wide analysis of mammalian ... linker (of oligo-25, 5’-GCGGTGACCCGGGAGATCTGAATTC, and oligo11, 5’-GAATTCAGATC) using T4 DNA ligase (New England Biolabs) overnight at 16°C DNA was ethanol precipitated and amplified by ligation-mediated ... 43 Carninci P, Sandelin A, Lenhard B, Katayama S, Shimokawa K, Ponjavic J, Semple CA, Taylor MS, Engstrom PG, Frith MC, Forrest AR, Alkema WB, Tan SL, Plessy C, Kodzius R, Ravasi T, Kasukawa T,...

Ngày tải lên: 09/08/2014, 20:21