... discovery of the singular relations of the animals and plants inhabiting the several islands of the Galapagos archipelago, and of all of them to the inhabitants of South America As far as I can ... stiff a book it is, this is a large sale It has been translated into almost every European tongue, even into such languages as Spanish, Bohemian, Polish, and Russian It has also, according to Miss ... messing by ourselves in the same cabin We had several quarrels; for instance, early in the voyage at Bahia, in Brazil, he defended and praised slavery, which I abominated, and told me that he had...
Ngày tải lên: 23/03/2014, 05:20
... further away from reflect increasingly impaired bilateral coordination Impairments in gait asymmetry and bilateral coordination of gait in stroke patients The gait of the stroke patients is characterized ... ideal 180° line All this results in about a fold higher PCI value for this stroke patient This example is consistent with the group findings; the average PCI was about times larger in the patients, ... this rhythmical task [27] Imbalance in motor pathway integrity might lead to this instability [28] The gait of healthy young adults who intentionally slow down is characterized by increased intra-...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo khoa học: "The clinical value of daily routine chest radiographs in a mixed medical–surgical intensive care unit is low"
... clinically relevant and irrelevant findings, and simply reported on all abnormalities [12] At present, in many ICUs CXRs are still routinely obtained on a daily basis, at least in The Netherlands ... study and manuscript revision JK was involved in the design and statistical analysis of the study MS conceived and coordinated the study and was involved in the interpretation of the data and manuscript ... this journal on the utility of daily routine CXRs in clinical decision making in the ICU In that study, a questionnaire was completed for each radiograph, addressing the indication for the radiograph...
Ngày tải lên: 25/10/2012, 10:39
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
... next article mentions that particular vitamins are ingredients in a skin cream for use with skin that has been damaged by wind, sun or shaving Another excerpt notes that a particular company sells ... that this evidence establishes that the goods are related The first article indicates that skin toner, cologne and skin cream contain vitamins The second article contains recipes for skin care ... products based on fruits and vegetables A third article discusses exfoliating skin creams which contain appeal, the appliction would have to be remanded to the Examining Attorney for appropriate amendment...
Ngày tải lên: 20/12/2013, 23:15
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT ... GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298 PAI-2) Reverse (nt 1860–1843 PAI-2) Forward (nt 1491–1508 PAI-2) Reverse...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Yeast glycogenin (Glg2p) produced in Escherichia coli is simultaneously glucosylated at two vicinal tyrosine residues but results in a reduced bacterial glycogen accumulation docx
... peptide mixture, as obtained by cyanogen bromide and a- amylase treatment, is shown in Fig 3A As revealed by MALDITOF analysis, several eluate fractions contained an 11-mer peptide having the sequence ... i.e a mass of 28 Da y-Type fragments are C-terminal [28] Probably due to a loss of NH3 from asparagine, many fragments show a satellite peak at )17 Da Fragments bearing a glucosyl moiety are marked ... change, the level of a relatively small maltodextrin is increased more than threefold that, as judged from HPAEC, has a DP of approximately It is remarkable that the size of this maltodextrin is...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx
... CTAGCTAGAATTC-3¢ for a1 ; and 5¢-AGGTGATC ATATGCTTCTAGAGAAGAGTGAAATA-3¢ and 5¢-AG AGGATCCTCAGCCCATTTGGAGGGCGG-3¢ for b1 In each case, the forward primer introduced a unique NdeI restriction site that ... (440 kDa), catalase (232 kDa), aldolase (158 kDa), albumin (67 kDa) and ribonuclease A (13.7 kDa) serving as molecular standards (Amersham Bioscience) Analysis of the N-terminal amino-acid sequences ... Kawakami et al FAD, FMN and ATP-containing amino-acid dehydrogenase (dye-l-proDH) [3,4], and found these enzymes to be highly stable and to exhibit a high potential for application in amino-acid...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo khoa học: A novel prokaryotic L-arginine:glycine amidinotransferase is involved in cylindrospermopsin biosynthesis potx
... DNA Isolation Kit (MoBio, Carlsbad, CA, USA), according to the manufacturer’s instructions PCR amplification of cyrA was performed using primers cyrA-F (5¢-CATATGCAAACAGAATTGTAAATAGCT3¢) and cyrA-R ... replaced by the smaller amino acids alanine and threonine This results in a much larger active site than in AGAT, and allows for binding of inosamine phosphate, the substrate of StrB1 [31] CyrA ... l-Alanine, b-alanine, c-aminobutyric acid, ethanolamine, taurine, l-lysine, a- amino-oxyacetic acid and l-norvaline were used as amidino group acceptors The limit of detection for the assays was...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: "Transparent combination of rule-based and data-driven approaches in a speech understanding architecture" pot
... concludes Semantic analysis as classification This section describes an abstract architecture which characterises semantic analysis as a task slightly extending the "decision-list" classification algorithm ... not a great deal of training data available, and the statistical methods used are simple and unsophisticated However, we still get a significant improvement on rules alone by adding a trainable ... pattern((Pattern), (Atom), (Example)) where (Pattern) is a pattern, (Atom) is an atom it predicts, and (Example) is an example of an utterance that should contains this pattern Continuing the example, a possible...
Ngày tải lên: 08/03/2014, 21:20
Báo cáo khoa học: "A Comparison of Rule-Invocation Strategies in Context-Free Chart Parsing" pot
... recursion worse than Earley's algorithm, illustrates this: Assume a grammar with rules S * Ae, A * aA, A -* b and a sentence aa a a a b c" to be parsed Here a bottom-up parser such as Kilbury's ... University, LinkSping, Sweden Pereira, Fernando C N and David H D Warren (1980) Definite Clause Grammars for Language Analysis A Survey of the Formalism and a Comparison with Augmented Transition ... used in these experiments have been obtained from Masaru Tomita and can be found in his book (Tomita 1986) Grammars I and II are toy grammars consisting of and 43 rules, respectively Grammar III...
Ngày tải lên: 09/03/2014, 01:20
Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc
... Dewpura et al endogenous inhibitor, a catalytic domain characteristic of serine proteases and a C-terminal Cys- and His-rich domain implicated in enzyme stability and protein– protein interaction ... the prodomain, the common naturally occurring A5 3V variation that has no significant effect on plasma cholesterol levels and the R46L variation, a naturally occurring variant associated with hypocholesterolemia ... several post-translational modifications; while in the ER it is glycosylated at a single N-linked site at amino acid 533 that is further matured in the Golgi increasing the molecular mass of secreted...
Ngày tải lên: 16/03/2014, 06:20
Does This Make Me Look Fat? Aesthetic Labor and Fat Talk as Emotional Labor in a Women''''s Plus-Size Clothing Store potx
... that term, insisting (accurately) that what has been called ‘plus-size’ is in fact average,” (p xxxi) Indeed, as described above, Real Style’s in- store, television, and catalogue marketing campaigns ... small or flat In one case, a Latina customer was having trouble finding a pair of jeans with a good fit, when Gia, a plus-sized Latina sales associate, gently suggested that the customer try a ... Conditions Does This Make Me Look Fat? so long as this does not clearly discriminate against protected categories (Avery and Crain 2007; see also Rhode 2010); workplace discrimination on the basis of “style”...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: A novel serine protease highly expressed in the pancreas is expressed in various kinds of cancer cells potx
... serine protease family, testisin and prostasin, are also expressed in ovarian carcinomas [31,32] Immunohistochemical analysis demonstrated the expression of prosemin in clinical ovarian carcinomas, ... such as carboxypeptidase Y in yeast, subtilisin, a- lytic protease, and aqualysin in bacteria (reviewed in [26]) When a histidine tag was fused with the prosemin catalytic domain using the pTrcHis ... sequence was amplified from human pancreatic cDNA using the primer set (forward, CCCA AGCTTACCATGAATCTACTCCTGAT; reverse, GTTG GTACCTTGTCATCATCATCAAAGG), and inserted into the pcDNA3 vector (Invitrogen)...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx
... over a much wider range of operation than that for which the model was originally intended It has been suggested [17] that inductive, multivariate and machine learning approaches are appropriate ... base model for parameter scanning using routines contained in GEPASI METHODS Model A model of branched glycolysis, as described in [7] was obtained in SCAMP format from one of its authors (a ... t-tests and Spearman’s rank correlation analysis were performed as described in [22,23] and using tables therein Principal components analysis (PCA) [24–26] was performed using HOBBES, an in- house...
Ngày tải lên: 17/03/2014, 11:20
Báo cáo khoa học: An estrogen receptor a suppressor, microRNA-22, is downregulated in estrogen receptor a-positive human breast cancer cell lines and clinical samples pptx
... microRNA represses cell proliferation pathways in human cells Cancer Res 67, 7713–7722 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y & Takahashi ... Peking Union Medical College (Beijing, China) and maintained in our laboratory HEK293T (American Type Culture Collection, Manassas, VA, USA) and MCF-7 cells were maintained in 10% fetal bovine ... 5¢-GUG GAUAUUGUUGCCAUCA-3¢ The sequences of two siRNAs for ESR1 are as follows: ERa siRNA #2 sense strand 5¢-UCAUCGCAUUCC UUGCAAAdTdT-3¢, antisense strand 5¢- UUUGCAAGGAAUGCGAUGAdTdT-3¢; ERa siRNA...
Ngày tải lên: 22/03/2014, 21:20