sentence disambiguation by a shiftreduce parsing technique

IN VIVO MECHANICAL AND PHYSIOLOGICAL CHARACTERISATION OF LOWER LIMB SOFT TISSUE BY a LOCAL INDENTATION TECHNIQUE

IN VIVO MECHANICAL AND PHYSIOLOGICAL CHARACTERISATION OF LOWER LIMB SOFT TISSUE BY a LOCAL INDENTATION TECHNIQUE

... value and an analysis was carried out By comparing the FE analysis results with the experimental indentation depths, an estimation of Young’s modulus was obtained In a similar FE approach, Vannah ... this area is getting relatively mature as more and more commercial CAD socket design systems are available A method for defining and comparing manual socket modifications quantitatively was developed ... specific anatomical areas like the patella tendon, popliteal fossa, and the medial tibia flair as such areas are more pressure-tolerant Relief is given to the more pressure-sensitive areas such as

Ngày tải lên: 09/10/2015, 11:24

143 597 0
A study on common errors in sentence construction by secondary schoolers in haiphong city

A study on common errors in sentence construction by secondary schoolers in haiphong city

... the Asian Trade group ASEAN and the official language of the European Bank In fact, with the spread of globalization and the rapid expansion of information and technology, there has been an explosion ... So errors are no longer “bad” but “good” or natural just as natural as errors that occur in learning a first language The insight that errors are a natural and important part of the learning process ... errors and mistakes He defined that an error is “a noticeable deviation from the adult grammar of a native speaker, reflecting the inter language competence of the learner”, meanwhile, a Trang 17mistake

Ngày tải lên: 07/11/2018, 12:34

55 215 1
Luận văn a study on common errors in sentence construction by secondary schoolers in haiphong city

Luận văn a study on common errors in sentence construction by secondary schoolers in haiphong city

... have a complete idea that stands alone This is also called an independent clause A simple sentence contains a subject and a verb, and it may also have an object and modifiers However, it contains ... language learners, particularly in the case of Arabic speakers The tense system in Arabic differs greatly from that of the target language, leading to frequent inter-language errors Additionally, ... garden with many tree Lucy’s house has a big garden with many trees Annie and me saw a movie yesterday Annie and I saw a movie yesterday I gave she a gift I gave her a gift Nomialization He likes

Ngày tải lên: 05/08/2021, 21:05

55 8 0
Adhesion patterning by a novel air lock technique enables localization and in situ real time imaging of reprogramming events in one to one electrofused hybrids

Adhesion patterning by a novel air lock technique enables localization and in situ real time imaging of reprogramming events in one to one electrofused hybrids

... culture and time-lapse microscopy, we implemented a two-step approach of air-lock bovine serum albu-min patterning and Matrigel coating to create localized adhesion areas around the micro-slits As a ... was fabricated by photolithography It consisted of two parallel feeder channels sepa-rated by a vertical PDMS wall with micro-slits (slit width 3–4 lm) for cell alignment by DEP and fusion by ... the matrix protein is excluded from the BSA-coated channel floor but instead become adsorbed onto the BSA-free areas In this way, we could create localized Matrigel-coated adhe-sion areas around

Ngày tải lên: 19/11/2022, 11:41

14 4 0
Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling

Inactivation of microorganisms in untreated water by a continuous flow system with supercritical CO2 bubbling

... Higashimita, Tama-ku, Kawasaki, Kanagawa, 214-8571, Japan ** Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, 562, Nanatsuka, Shobara, Hiroshima 727-0023, Japan ... Trang 1Inactivation of microorganisms in untreated water by a Fumiyuki KOBAYASHI*, Futoshi YAZAMA**, Hiromi IKEURA*, Yasuyoshi HAYATA* Norio MUTO** and Yutaka OSAJIMA*** * School of Agriculture, ... 2646-2649 Japan Water Works Association (JWWA) (2001) The method of Japan Water Works Association p.573-613 (in Japanese) Kobayashi, F., Hayata, Y., Kohara, K., Muto, N., Miyake, M and Osajima, Y (2006)

Ngày tải lên: 05/09/2013, 09:38

10 451 1
Divided by a Common Language

Divided by a Common Language

... Cataloging-in-Publication Data 1 English language—Great Britain—Glossaries, vocabularies, etc 2 English language—United States—Glossaries, vocabularies, etc 3 English language—Variation—Great ... Britain—Handbooks, manuals,etc 4 English language—Variation—United States—Handbooks, manuals,etc 5 English language—Great Britain—Handbooks, manuals, etc 6 English language—United States—Handbooks, ... [kie-oh-tee]adobe, "a brick of clay and straw" [a-doh-bee] mesa, "a high piece of land" [may-sa] Here are a few Spanish place names and their American pronunciations: Lajolla, in California

Ngày tải lên: 08/12/2013, 11:59

261 281 1
Spanish Savings Banks and their Future Transformation into Private Capital Banks.Determining their Value by a Multicriteria Valuation Methodology doc

Spanish Savings Banks and their Future Transformation into Private Capital Banks.Determining their Value by a Multicriteria Valuation Methodology doc

... (Aragonés, Aznar, Ferris & García- Melón, 2008, Garcia-Melón, Ferrís-Oñate, Aznar-Bellver, Aragonés-Beltrán & Poveda-Bautista, 2008) and a combination of several of these techniques (Aznar, ... International Valuation Standards (2007) and is defined as “A factor wherein a value or price serves as the numerator and financial, operating, or physical data serve as the denominator”, its mathematical ... regression analysis, require a comprehensive database of comparable assets In numerous cases the available database is not large enough, as is a common problem in the case of business valuation 2)

Ngày tải lên: 06/03/2014, 10:20

10 335 0
Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx

Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx

... phosphorylation are also controlled by eIF2a-phosphatase activities that specifically dephosphorylate this site This is proposed as a feed-back mechanism, allowing translational recovery on cellular ... the activation of eIF2a-kinases Nck fails to alter GCN2-mediated eIF2aSer51 phosphorylation To ascertain that the effect of Nck-1 on eIF2aSer51 phosphorylation by eIF2a-kinases is a general phe-nomenon, ... < 0.01. Trang 4both functionally and structurally similar to mamma-lian GCN2 (reviewed in [2]) In yeast, phosphorylation of eIF2a by Gcn2p upon amino acid starvation leads to an increase in the

Ngày tải lên: 07/03/2014, 05:20

11 378 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx

... strategy was also used to mutate the alcohol dehy-drogenase distal factor (Adf-1) element using the specific primer 5¢-CCGTCGACATTAATTTGAGAAATTATAT TGCGTCGCccgccggcCgcCacgGAGGGTGAC-3¢ (again the SalI ... melanogaster a-F1-ATPase gene We have previously characterized a cDNA encoding the D melanogastera-F1-ATPase subunit [27] To isolate the corresponding D melanogaster a-F1-ATPase gene and flanking ... rafael.garesse@uam.es Abbreviations: Adf-1, alcohol dehydrogenase distal factor; GAF, GAGA factor; OXPHOS, oxidative phosphorylation; n-DNA, nuc-lear DNA; mtDNA, mitochondrial DNA; NRF, nucnuc-lear respiratory

Ngày tải lên: 07/03/2014, 16:20

11 534 0
Báo cáo khoa học: Induction of raft-like domains by a myristoylated NAP-22 peptide and its Tyr mutant potx

Báo cáo khoa học: Induction of raft-like domains by a myristoylated NAP-22 peptide and its Tyr mutant potx

... Trang 1peptide and its Tyr mutantRaquel F Epand1, Brian G Sayer2 and Richard M Epand1,2 1 Department of Biochemistry and Biomedical Sciences, McMaster University, Hamilton, Canada 2 Department ... amino terminal fragment of NAP-22 is that the first 21 amino acids are invariant among NAP-22 of several mammalian species and this segment differs by only one residue with chicken NAP-22 (CAP-23) ... wet DSC Measurements were made using a Nano Differential Scan-ning Calorimeter (Calorimetry Sciences Corporation, American Fork, UT, USA) The scan rate was 2CÆmin)1 and there was a delay of 5

Ngày tải lên: 07/03/2014, 17:20

12 370 0
Báo cáo khoa học: Three-step hydroxylation of vitamin D3 by a genetically engineered CYP105A1 doc

Báo cáo khoa học: Three-step hydroxylation of vitamin D3 by a genetically engineered CYP105A1 doc

... Kurokawa, Imizu, Toyama, Japan Fax: +81 766 56 2498 Tel: +81 766 56 7500 E-mail: tsakaki@pu-toyama.ac.jp Database Structural data are available in the Protein Data Bank database under the accession ... fragment containing R73V⁄ R84A and FDX1 genes, with HindIII and PstI restriction sites, was prepared using the primers 5¢-ACCAAGCTTATGAAAAGATACCGCCAC-GACG-3¢ and 5¢-TTCTGCAGTCACCAGGTGACCGG-GAGTTCG-3¢, ... Miyazaki A, Saito M, Adachi T, Mizoue K, Hanada K & Omura S (1992) Transformation of vita-min D3 to 1 alpha,25-dihydroxyvitavita-min D3 via 25-hydroxyvitamin D3 using Amycolata sp strains Appl

Ngày tải lên: 15/03/2014, 23:20

11 505 0
"Shiloh" as Seen by a Private Soldier With Some Personal Reminiscences pptx

"Shiloh" as Seen by a Private Soldier With Some Personal Reminiscences pptx

... their armies When in the Franco-Prussian war a German regiment was called upon for a charge, each man felt that the order was given because it was necessary, and that what he was doing was part ... Buell's army at Savannah; and has no thought of moving them up that day to repel an overwhelming attack about to be made on him On Saturday he visits his army and Sherman, and then goes back to Savannah, ... that campaign was not long in doubt In Napoleon's time, the confidence of the rank and file was such that time and again he was saved from defeat by the feeling of the attacked corps or detachment

Ngày tải lên: 16/03/2014, 01:20

19 254 0
Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exemplified by a novel neuronal protein, CASK-interactive protein1 pot

Báo cáo khoa học: High levels of structural disorder in scaffold proteins as exemplified by a novel neuronal protein, CASK-interactive protein1 pot

... C-terminal Caskin1 are functional and may interact with SH3 domain-containing proteins, such as Abi2 [We have also found an in vivo association and colocalization of Abi2 with Caskin1 (A Balazs, ... region and its fragments from the bacterial extracts was started by boiling the proteins at 100C for 5 min and loading the supernatants on an Ni–agarose affinity chromatograph The heat stability ... Trang 1exemplified by a novel neuronal protein, CASK-interactive protein1 Annama´ria Bala´zs1,*, Veronika Csizmok2,*, La´szlo´ Buday1,2, Marianna Raka´cs2, Robert Kiss3, Mo´nika Bokor4,

Ngày tải lên: 16/03/2014, 02:20

13 408 0
Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt

... (5¢-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3¢) and PMluI (5¢-GTACACGCG TCTGATCAG-3¢) were inserted into the 3¢-end of the pYES2–VPP plasmid to generate the V-PPase–(His)6tail The ... 3A) Figure 3A1 shows a planar lipid bilayer reconstituted with V-PPases and ana-lyzed by immunofluorescence using a primary anti-body against His followed by a Cy3-conjugated secondary antibody; ... (approximately 5.6 : 4.4) Fig 5 AFM analysis of V-PPase in a reconstituted lipid bilayer immunolabeled with an antibody against His to detect the C-terminal 6·His tag of V-PPase (A) Image of a

Ngày tải lên: 16/03/2014, 02:20

14 334 0
Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc

Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc

... Imgenex (San Diego, CA, USA) Secondary anti-mouse and anti- (rabbit HRP) IgG were from Amersham (Piscataway, NJ, USA) and the secondary anti-(goat HRP) IgG was from Santa Cruz Biotechnology (Santa Cruz, ... sulfation of the prodomain, the common naturally occurring A53V variation that has no significant effect on plasma cholesterol levels and the R46L variation, a naturally occurring variant associated ... Disease Program, Ottawa Health Research Institute, The Ottawa Hospital, Canada 2 Laboratory of Biochemical Neuroendocrinology, Clinical Research Institute of Montreal, Canada Proprotein convertase

Ngày tải lên: 16/03/2014, 06:20

14 458 0
Báo cáo khoa học: Malonyl-CoA decarboxylase (MCD) is differentially regulated in subcellular compartments by 5¢AMP-activated protein kinase (AMPK) Studies using H9c2 cells overexpressing MCD and AMPK by adenoviral gene transfer technique potx

Báo cáo khoa học: Malonyl-CoA decarboxylase (MCD) is differentially regulated in subcellular compartments by 5¢AMP-activated protein kinase (AMPK) Studies using H9c2 cells overexpressing MCD and AMPK by adenoviral gene transfer technique potx

... N.B & Saha, A.K (2002) Coordinate regulation of malonyl-CoA decarboxylase, sn-glycerol-3-phos-phate acyltransferase, and acetyl-CoA carboxylase by AMP-activated protein kinase in rat tissues ... funded by a grant from the Canadian Institute for Health Research N.S is a postdoctoral fellow of the Alberta Heritage Foundation for Medical Research and Heart and Stroke Foundation of Canada J.R.B.D ... normal aerobic heart [5,6], malonyl-CoA has a key role in regulating cardiac energy metabolism Tissue levels of malonyl-CoA are determined by its rate of synthesis by acetyl-CoA carboxylase (ACC) and

Ngày tải lên: 16/03/2014, 16:20

10 399 0
Báo cáo khoa học: Netropsin interactions in the minor groove of d(GGCCAATTGG) studied by a combination of resolution enhancement and ab initio calculations pot

Báo cáo khoa học: Netropsin interactions in the minor groove of d(GGCCAATTGG) studied by a combination of resolution enhancement and ab initio calculations pot

... contain A and T bases in the central part of the DNA (seven contain an AATT tract and two contain a mixed ATAT tract) Only three structures, GDLB31 [9], GDL014 [11] and GDJ046 [12], are class ... contact distance between an ami-dinium or guaniami-dinium atom and a N2 guanine atom (N10(Nt)ÆÆÆN2(G9)) is 3.32 A˚ In 10-DAPI and 10-Dst the contact distance between amino group and amidi-nium atoms ... (3.29 A˚) N8(Nt) contacts O2(T8) (2.84 A˚) and makes a large contact with N3(A26) (3.60 A˚) Also the Nt terminal guanidinium N1 and amidinium N10 atoms are hydrogen bonded to N3(A5) (3.21 A˚) and

Ngày tải lên: 16/03/2014, 22:20

11 484 0
Báo cáo khoa học: "Answer Sentence Retrieval by Matching Dependency Paths Acquired from Question/Answer Sentence Pairs" pdf

Báo cáo khoa học: "Answer Sentence Retrieval by Matching Dependency Paths Acquired from Question/Answer Sentence Pairs" pdf

... operator This increases the chance that the evaluation set actually con-tains valid answer sentences significantly In order to provide a quantitative characteriza-tion of the two evaluacharacteriza-tion ... difdif-ferent from each other Thus it is natural to compare our approach against a baseline that compares can-didate sentences not against patterns that were gained from question/answer sentence pairs, but ... system used as a baseline is at an advantage in at least two respects: a) It has important web-based components and as such has access to a much larger body of textual informa-tion b) The algorithm

Ngày tải lên: 17/03/2014, 22:20

11 331 0
Báo cáo khoa học: Targeting mechanism of the retinoblastoma tumor suppressor by a prototypical viral oncoprotein Structural modularity, intrinsic disorder and phosphorylation of human papillomavirus E7 doc

Báo cáo khoa học: Targeting mechanism of the retinoblastoma tumor suppressor by a prototypical viral oncoprotein Structural modularity, intrinsic disorder and phosphorylation of human papillomavirus E7 doc

... Trang 1suppressor by a prototypical viral oncoproteinStructural modularity, intrinsic disorder and phosphorylation of human papillomavirus E7 Lucı´a B Chemes, Ignacio E Sa´nchez, Clara Smal and ... antigen (SV40LT) and adenovirus E1A (AdE1A) also target the Rb protein and share sequence and functional conservation with the HPV E7 protein [21,22] E7, AdE1A and SV40LT each con-tain several ... protein with a viral target in solution, integrated with structural data and the analysis of other cellu-lar and viral proteins, which provided information about the balance of interactions involving

Ngày tải lên: 22/03/2014, 21:20

16 407 0
Hanging by a Thread potx

Hanging by a Thread potx

... drums,and he went on with his tirade in a fine flush of fury Alas … poor Jayjay Actually, Jayjay Kelvin can't be blamed for his attitude All he was ing was that it was highly improbable that a spaceship ... fifteen pounds Captain Atef al-Amin was staring up at the stairs as Jayjay camedown He was jammed tightly into a space between two of the big con-trol cabinets, hanging head downward and looking ... cozily small; the Persephone had not been designed as a passenger vessel, and the two passengers she was carrying at the time had been taken on as an accommodation rather than as a money-making

Ngày tải lên: 23/03/2014, 00:20

30 267 0

Bạn có muốn tìm thêm với từ khóa:

w