semantic extensions and a novel approach to conceptual modelling

... [6,9], and variation of intercellular lipids [10], to name a few As such, a wide variety of physiological and pathological conditions can be analyzed, in a more systematic and practical way Theory ... Trang 1R E S E A R C H Open AccessA novel approach to modelling water transport and drug diffusion through the stratum corneum Tatiana T Marquez-Lago1,2*, Diana M Allen3*, Jenifer Thewalt4 ... Burnaby, BC, V5A 1S6, Canada Abstract Background: The potential of using skin as an alternative path for systemicallyadministering active drugs has attracted considerable interest, since the creation

Ngày tải lên: 13/08/2014, 16:20

... contractions plotted as the fraction of original area after wounding The original wounded area at day 0 is defined as 100 percent original area; the areas at day 3, 6 and9 are calculated as the ... gastrointestinal, respiratory and genitourinary systems, to neurotransmission and a role in immune function and inflammation The body appears to use at least one other, highly related gas in a signaling ... Constitutive and inducible NO production regulates many essential functions such as maintaining background vasodilatation in small arteries and arterioles, regulation of microvascular and epithelial permeability

Ngày tải lên: 26/09/2015, 09:39

... test to measure LPS 39 1 H MRS for the determination of hepatic and muscular fat content 39 Lactobacillus reuteri capsules and placebo capsules 40 Statistical data analysis and power calculation ... epithelial barrier function by affecting both para-cellular and trans-cellular pathways GLP-2 treatment has been shown to increase intestinal weight and mucosal thickness, surface area and cryptic architecture ... cell wall of gram-negative bacteria, in the peripheral blood are associated with low-grade inflammation (Caradonna et al., 2000; Cani et al., 2012; Cani and Delzenne, 2009c; Andreasen et al.,

Ngày tải lên: 19/11/2015, 16:47

... Shore, and he was great at being charming and always on call — which was what contributed to him being atotal nightmare as a husband He was always busy, always working weekends and neveraround And ... realised of course someone like Jayne would have kids and ahusband — she was way too good a catch to have stayed single Jayne saw him staring atthe basket and shrugged — she had nothing to be ashamed ... family sat together and talked Sure, somedays the conversation was better than others, but it meant a lot to Karen and Russ tocheck in as a family Karen rushed to get the pasta on as she heard

Ngày tải lên: 03/01/2020, 10:40

... the average value of all the pixels that greater than zero), kurtosis (a measure of peakedness and tailedness of the histogram The positive kurtosis means a histogram that is more peaked than a ... homograft-bearing mice were randomized into three groups: control, paclitaxel monotherapy and com-bination therapy with antiangiogenic bevacizumab (Avas-tin, Roche, Switzerland) and paclitaxel All of ... diameter small animal coil (GE, Waukesha, USA) The animals were anesthetized by an in-traperitoneal injection of 1% pentobarbital sodium with a volume of 150 μl Heartbeats and respiration rates

Ngày tải lên: 03/07/2020, 01:25

... https://www.cancer.org/content/dam/cancer-org/research/cancer-factsand-statistics/annual-cancer-facts-and-figures/2018/cancer-facts-andfigures-2018.pdf Güth U, Magaton I, Jane D, Fisher R, Schötzau A, Vetter M Primary and secondary distant metastatic breast ... (originally referred to as “synergism” by Chou and Talalay), 0.7 to 0.85 a “moderate” and 0.85 to 0.9 a “slight” synergism Values from 0.9 to 1.1 show an “additive” effect and a CI above 1.1 indicates ... as well as DCA, NHI-2 and their combination (c, d) and) for 48 h Then, viability was assessed using MTT assay (a, c) and protein mass was assessed using SRB assay (b, d) CIValues were calculated

Ngày tải lên: 06/08/2020, 05:17

... delay and approximately linear-phase frequency response in the passband and the transition band and (ii) Design of synthesis prototype filter such that the filter bank pairs distortion function approximates ... yield a convex optimization problem 3.2.1 Passband Narrow-band low-pass filters usually not exhibit a distinctive passband In order to obtain a narrowband low-pass filters it is sufficient to ask for ... passband and the transition bands As the objective function to be minimised we adopt a particular representation of the group delay [20], while the stopband magnitude specifications of the prototype

Ngày tải lên: 21/06/2014, 19:20

... (b) according to ASAP and ALAP schedule. sequential device. It has to be stated that T min and T total are lower and upper bounds since their exact calculation in most cases is a hard optimisation ... available silicon area (hardware capacity), B. Knerr et al. 3 memory (software capacity), and latency as a timing con- straint. The global criticality/local phase (GCLP) algorithm is basically ... 1). This modification was mandatory for the comparison to the parti- tioning techniques of Wiangtong et al. [9] and Kalavade and Lee [8]. To the best of our knowledge, Wiangtong et al. [9] were

Ngày tải lên: 22/06/2014, 06:20

... La Fondation Armand-Frappier and the Canadian Arthritis Network. References 1. Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular ... metalloproteinase 9 (96-kd gelatinase B) in human rheumatoid arthritis. Arthritis Rheum 1996, 39:1576-1587. 3. Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases ... metalloproteinases and their inhibitors to cartilage proteoglycan and collagen turnover and inflammation as revealed by analyses of synovial fluids from patients with rheumatoid arthritis. Arthritis

Ngày tải lên: 09/08/2014, 08:22

... sequence and possible binding sites pax6 1.1 (UCSC) CTTAATGATGAGAGATCTTTCCGCTCATTGCCCATTCAAATACAATTGTAGATCGAAGCCGGCCTT GTCAsGTTGAGAAAAAGTGAATTTCTAACATCCAGGACGTGCCTGTCTACT *Minimal fragment for ... AAAAnTGTACTTTTTTAGTATTTACyT *HoxA5 (TTTAaTAaTTA), TTTAGTATTTA: 14-24 + CdxA, M00101, AWTWMTR: 16-22 - (0.979) SRY, M00148, AAACWAM: 7-13 - (0.928) Hoxb2 2.3 (UCSC) GTGTGTTCTAGTGAACATTTTCATATATATTTATTGGTTAT *Glucocorticoid ... based on the random analysis (see Materials and methods) The four remaining motifs could not be recovered All motifs described by Kammandel et al [47] as conserved among mammalian and Fugu pax6

Ngày tải lên: 14/08/2014, 16:20

... and S1d) Given that caspase-3 acts downstream of all other apoptotic caspases as the central effector caspase of both extrinsic and intrinsic apoptosis, any (even a small) apoptotic caspase activation ... caspase activation would ultimately translate into activation of caspase-3 and thus into an accumulation of cleavage fragments of PARP-1 and caspase-3 However, this was only detectable in the ... with TRAIL/ zVAD/CHX did not cause an increase of the 89-kDa PARP-1 cleavage fragment that is generated in apoptosis by activated caspase-3 Likewise, no increase in activated, cleaved capase-3

Ngày tải lên: 05/11/2020, 01:07

... that ofthe robot Motors may lead to significant downtime and added cost Another option Trang 17is to attach a pneumatic rotary actuator to the end of a SCARA type robot toprovide an added DOF An ... industrial approach to solving this problem is to attach an electricalrotary actuator to the end of a SCARA type robot to provide an added DOF.However, electrical rotary actuators require a separate drive ... underactuated systems that take advantage of the dynamics of the system to manipulate a part Lynch and Mason [14] created a one DOF robot that manipulates a part by flipping it in the air and

Ngày tải lên: 25/10/2022, 03:18

... collection was carried out at the 22-ID beamline at the Advanced Photon Source (Argonne National Laboratory) The data was processed and scaled using the HKL2000 package26 Molecular replacement was carried ... Trang 1Protein rethreading: A novel approach to protein design Sayeh Agah*, Sandra Poulos*, Austin Yu, Iga Kucharska & Salem Faham Protein engineering is an important tool for the ... demonstrated experimentally Protein rethread-ing can be a challengrethread-ing process An apparent challenge is that all structural rearrangements have to be carried out successfully simultaneously to

Ngày tải lên: 04/12/2022, 16:06

... Committee Assoc Prof Dr Hasan Abdullah (BL), Assist Prof Dr Alias Abdulrahman (MAL), Assist Prof Dr Abdullah Aksu, (TR); Prof Dr Hasan Atar (TR), Prof Dr Lale Balas (TR), Prof Dr Levent Bat (TR), Assoc ... operator uses the nose interest region and analysis horizontal and vertical histograms This operator creates two different horizontal histograms and one vertical histogram The nose holes are darker ... their natural abilities without any additional equipment It is very difficult to create an automated system for the identification task (Samal and Iyengar, 1992) The developments in hardware and software

Ngày tải lên: 10/02/2023, 19:53

... program, taking care of such tasks as transferring command-line arguments (see Chapter 5) to main and main’s return value back to the operating system We are finally ready to treat program ... Program There is no faster way to crash a program than to make a mistake with memory (Actually, this statement overstates the case: a program need not crash immediately after an erroneous ... chapter covers both for two reasons First, manipulating... the addresses are the particular values that they are later Each cell is annotated with its associated variable and the type of that

Ngày tải lên: 19/03/2014, 14:05

... Predicate relevant activity(org, a) where org is an organization and a an activity to define activities that are relevant in a given organization, (3) Predicate relevant view(org, v) where org is an ... specification long to properly generate fire- wall configuration rules. There are other attempts to suggest such a top-down approach. For instance, [Hassan and Hudec, 2003] applies the RBAC model [Sandhu ... languages. There are some tools that help administrators to build their security pol- icy and to translate it to the actual configuration language (for instance Cisco PIX [Degu and Bastien, 2003],

Ngày tải lên: 28/03/2014, 22:20

... translate into operational solutions without standardized indicators that break the factors down into observable and measurable units Standard indicators for each capacity factor, adaptable to contexts ... ―capacity indicators‖ are therefore the primary operational targets of any capacity development program The capacity indicators are measurable, so as to permit analysis and benchmarking The capacity ... instruments, and effective organizational arrangements, as well as an illustrative list of indicator sources and databases that can be used for their assessment Some of the readily available indicator data

Ngày tải lên: 30/03/2014, 01:20

... of training data and two weeks of test data. Among these datasets, we used attack-free training data for nor- mal behavior modeling, and attack data was used to the construction of anomaly score ... Markov Model-based approach and the updated performance analysis, and overall parts like abstract, introduction, and conclusion are rewritten, and the main approach in Section 4 was also fully revised ... The simulated attacks were included in one of following five categories, and they had DARPA attacks and generated attacks: (i) Denial of Service: Apache2, arppoison, Back, Cra- shiis, DoSNuke, Land, Mailbomb,...

Ngày tải lên: 21/06/2014, 05:20

... Nga K 1 1A 30 Graduation paper Declaration Title: A new approach to semantic and syntactic functions of English adjectives A contrastive– analysis with their Vietnamese equivalents (Graduation ... is a study to a new approach to semantic and syntactic functions of English adjectives. Chapter IV is to make a contrastive analysis between English adjectives and their Vietnamese equivalents, ... stative or dynamic contrast, as it related to adjectives, is largely a semantic one, though as we have seen it also has syntactic implications. 2.2.2 Gradable and non- gradable adjectives According...

Ngày tải lên: 10/04/2013, 14:46

... into potential errors (bias and random error) related to data based on clinical examina- Acta Veterinaria Scandinavica 2009, 51:36 http://www.actavetscand.com/content/51/1/36 Page 8 of 10 (page ... of variation and bias in relation to monitoring of animal disease incidence on herd and national level, causal analysis on national level, as well as estimation of validated treatment criteria. Monitoring ... metritis' that relate to the quality of the data that are produced. We analyse and build &apos ;a model of understanding' based on DBL's observations and the indi- vidual veterinarians'...

Ngày tải lên: 25/10/2012, 10:45