selecting for genes with standard deviation gt 0 7
Báo cáo hóa học: " Abstract Despite new additions to the standard of care therapy for high grade primary malignant brain tumors, the prognosis for patients with this disease is still poor." ppt
... Cedars-Sinai (NCT00576537, NCT00576446) using DC pulsed with autologous tumor cell lysates with or without intratu-moral Gliadel wafer recently were closed for accrual At Duke University (NCT00890032), ... Med 2010, 363:411-22. doi:10.1186/1479-5876-8-100 Cite this article as: Hickey et al.: Cellular and vaccine therapeutic approaches for gliomas Journal of Translational Medicine 2010 8:100. Submit ... potential targets for immunotherapy J Neurooncol 2008, 88:65-76. 20 Bao L, Sun Q, Lucas KG: Rapid generation of CMV pp65-specific T cells for immunotherapy J Immunother 2007, 30:557-61. 21 Kruse...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo khoa học: " Decreased duration of mechanical ventilation when comparing analgesia-based sedation using remifentanil with standard hypnotic-based sedation for up to 10 days in intensive care unit patients: a randomised trial [ISRCTN47583497]" pps
... Remifenta nil 0 5 10 15 20 25 12345678910 Days µgkg –1 h –1 Fentany l 0 0. 5 1 1. 5 2 2. 5 3 3. 5 12345678910 Days Mo rphi n e 0 0. 02 0. 04 0. 06 0. 08 0. 1 0. 12 0. 14 0. 16 0. 18 12345678910 Days ... -1 3.0 (3.35) µg kg -1 h -1 0.042 (0.028) mg kg -1 h -1 a Equivalent to 0.32 µg kg -1 min -1 . Figure 4 Mean total midazolam doseMean total midazolam dose. 0 200 400 600 800 1000 1200 Remifentanil ... (days)Kaplan–Meier survival plot of time to extubation (days). 0.00 0.20 0.40 0.60 0.80 1.00 0 1 2 3 4 5 6 7 8 9 10 Remifentanil (n =57) Comparator (n =48) Survival Function Time (days) to extubation...
Ngày tải lên: 12/08/2014, 22:21
Improve your skills writing for IELTS 6.0-7.5 with answer key: Part 2
... remained at approximately 4 000 or 5 000 between 2005 and 2009 c The number of men peaked towards the end of the period were just under 80 000 male prisoners in 2009 Trang 20Crime and money 12 Does ... 60 Trang 86 632 6,217 6.331 6.275 6,202 6238 6,055 6,054 9 764 :.i34 "4° 5,657 5,534 5.575 ' ' 5,214 4,551 4,690 The working world Practice Test 7 Task 1 You should spend about 20 minutes ... and 2010 Summarize the information by selecting and reporting the main features, and make comparisons where relevant Write at least 150 words Number of fatal work injuries, 1992-2010 7,000 ...
Ngày tải lên: 19/09/2020, 19:46
genome wide identification and characterization of reference genes with different transcript abundances for streptomyces coelicolor
... SCO0710a 0.381 SCO1544 0.282 SCO3183 0.2 SCO0710 3 SCO3183 0.431 SCO6185 0.431 SCO0710 0.31 SCO1544 4 SCO1544 0.53 SCO4758 0.464 SCO0301 0.43 SCO3183 5 SCO4758 0.586 SCO3183 0.474 SCO1544 0.5 ... SCO4758 6 SCO1962 0.666 SCO1962 0.654 SCO0710 0.53 SCO1962 7 SCO1453 0.728 SCO1453 0.431 SCO6185 0.63 SCO1453 8 SCO1596 0.779 SCO1596 0.53 SCO4758 0.64 SCO0301 9 SCO1519 0.803 SCO6218 0.859 SCO2742 ... 0.72 SCO2543 10 SCO2543 0.838 SCO2543 0.885 SCO1962 0.75 SCO1596 11 SCO0301 0.882 SCO1519 0.918 hrdB 0.86 SCO6218 12 SCO6218 0.926 SCO0301 0.928 SCO1519 0.92 SCO1519 13 SCO2742 0.97 SCO2742 0.98...
Ngày tải lên: 04/12/2022, 10:37
Báo cáo y học: "Does switching from oral extended-release methylphenidate to the methylphenidate transdermal system affect health-related quality-of-life and medication satisfaction for children with attention-deficit/hyperactivity disorder&
... 9) 30 (n = 9) 40 (n = 2) 50 (n = 3) 10 (n = 1) 10 15 20 30 10 (44.4) 0 (100.0) (33.3) (33.3) (50.0) 0 (22.2) (55.6) 0 0 (11.1) (50.0) (100.0) 15 (n = 1) 20 (n = 12) 30 (n = 7) 40 (n = 3) 50 (n ... 13) 10 27 (n = 24) 36 (n = 46) 45 (n = 2) 54 (n = 27) 10 (n = 3) 15 20 20 30 10 (4.2) 0 (66.7) (37.5) (2.2) 0 (33.3) 10 (41.7) 26 (56.5) (50.0) (3.7) (16.7) 19 (41.3) (50.0) 26 (96.3) 20 (n = ... 112) 10 mg (n = 23) (38.5) 15 mg (n = 30) (38.5) 20 mg (n = 52) (23.1) 30 mg (n = 59) 10 10 15 20 30 (100.0) (66.7) (14.3) 0 (33.3) (42.9) 0 0 (14.3) (66.7) (50.0) 0 (28.6) (33.3) (50.0) MTS...
Ngày tải lên: 25/10/2012, 10:06
INTERNATIONAL STANDARD IEC 60079-0
... transferred from IEC 60079-11 and IEC 60079-15 • Requirements for bonding transferred from IEC 60079-7 and IEC 60079-15 • Requirements for gasket retention transferred from IEC 60079-15 for wider applicability ... 1Electrical apparatus for explosive gas atmospheres – Part 0: General requirements Reference number IEC 60079-0:2004(E) INTERNATIONAL STANDARD IEC 60079-0 Fourth edition2004-01 This English-language ... custserv@iec.ch Tel: +41 22 919 02 11 Fax: +41 22 919 03 00 Copyright International Electrotechnical Commission Document provided by IHS Licensee=eni spa/5928701001, 03/02/2004 06:06:04 MST Trang 3 `,,,````,`,,``,`,,``,`,`,,,-`-`,,`,,`,`,,`...
Ngày tải lên: 20/08/2013, 08:27
Tài liệu Oracle Real Application Clusters: Quick Installation Guide for Oracle Database Standard Edition ppt
... Netscape Navigator 4.78, 4.79, 7.0.1, or 7.1.0 Operating System RAC for Windows 32-bit is supported on Windows 2000 with service pack 1 or higher or Windows Server 2003: RAC for Windows 64-bit ... Installation Guide for Oracle Database Standard Edition 10g Release 1 (10.1.0.2.0) for Windows Part No B13889-01 April 2004 Trang 2This document describes the tasks to install Oracle Database 10g Standard ... one of them with a private IP address and the other with the public IP address For a node using Windows 2000, for example, complete the following procedure to assign IP address information to...
Ngày tải lên: 21/12/2013, 04:17
Tài liệu Designing for Cisco Internetwork Solutions Version 15.0 ppt
... 640-861 (DESGN) Designing for Cisco Internetwork Solutions Version 15.0 640 - 861 Important Note, Please Read Carefully Study Tips This product will provide you questions and answers along with ... that will allow her to communicate with the corporate office located over 500 miles from her home She most be able to access the company web server and send e-mail with attachments throughout her ... the way in IT testing and certification tools, www.testking.com - 7- 640 - 861 QUESTION NO: 10 Which two Cisco router services perform network traffic analysis to assist in documenting a customer’s...
Ngày tải lên: 21/12/2013, 05:18
Tài liệu EMERGENCY PLANNING GUIDE FOR FACILITIES WITH SPECIAL POPULATIONS docx
... Designated Alternate DOE JOHN 124 Maple Drive Niceville, PA 15000 Home Work Cell Pager Email (724) 555-1212 (724) 444-1212 (712) 333-1212 (724) 222-1212 doejohn@aol.c Maintenance Supervisor Utility ... This Facility is ( √ if applicable): _ located within a 100-year flood plain _ located in a hurricane evacuation zone _ located within the 50 mile Emergency Planning Zone of a Nuclear Power ... out to have with you as you begin to go through this guide • Tips for doing Emergency Planning for populations with special needs If you do not have access to a computer, or are not comfortable...
Ngày tải lên: 23/12/2013, 00:15
Tài liệu Using Webobjects With Adobe Golive 5.0 pdf
... fields–which in HTML must be located within a form–they too must be located within a form If a page has more than one form, you must declare a WOStateStorage element within each form To insert a WOStateStorage ... Trang 2© 2000 Adobe Systems Incorporated All rights reserved.Using WebObjects ® with Adobe ® GoLive ™ 5.0 for Windows ® and Macintosh ® This manual, as well ... definition to Enum definitions allow for passing a suite of initial values to an object—for example, user-selectable items for a menu in a fill-in form Trang 102 Click the New Enum button ( ) on...
Ngày tải lên: 17/01/2014, 06:20
Tài liệu The international community and the “NTP for coping with CC” pdf
... Immediate support to formulation of the NTP (policy, strategy….): by June 2008! • Key role for ISGE to bring international agencies and some international experts into the formulation process ... should start that after 2020) Trang 52 What is needed, now and later? (b) • Formulate a strategic framework to achieve both policy aims • Stress the importance of and potential for synergies between ... Trang 1The international community and the “NTP for coping with CC” Koos Neefjes, UNDP ISGE Policy Dialogue Hanoi, 23 January 2008 Trang 2This presentation:1 Current international support...
Ngày tải lên: 24/01/2014, 00:20
Tài liệu The Center for Children with Special Needs Seattle Children’s Hospital, Seattle, WA doc
... mortality among children with sickle cell disease included bacterial infections, splenic sequestration crisis and acute chest syndrome Sickle cell disease affects 70,000 to 100,000 Americans, primarily ... Sickle cell pain forms a continuum from acute to chronic: • 30% never or rarely have pain • 50% have few episodes • 20% have frequent, severe episodes (6% of patients account for 30% of all painful ... Room, and reinforce strategies for positive interactions 4-Month Check by PRIMARY CARe PRoVIDeR • Perform routine well-child care • Give standard 4-month immunizations • Reinforce teaching...
Ngày tải lên: 12/02/2014, 12:20
Tài liệu Mechanical Ventilation for children with Lung Disease: ALI, ARDS, and Hypoxemic Respiratory Failure. docx
... Inspiratory Pressure 32; PEEP 12; FiO2 0.6 • Last ABG; 7.28/62/60/+3 • Lung Disease Severity Indicators – PaO2/FiO2 Ratio : 100 – Oxygenation Index (MAP *FiO2/PaO2) *100 = 19 • Fentanyl, Midazolam, Octreotide ... Keck School of Medicine Childrens Hospital Los Angeles Case Presentation • year old male with Leukemia with respiratory failure from Adenovirus pneumonia • days into ICU course develops acute ... to take child to OR for exploratory laparatomy to control bleeding Current Support • Conventional Mechanical Ventilation – SIMV Pressure Control + Pressure Support • Rate 20; Peak Inspiratory...
Ngày tải lên: 12/02/2014, 12:20
Báo cáo y học: "Elevated extracellular matrix production and degradation upon bone morphogenetic protein-2 (BMP-2) stimulation point toward a role for BMP-2 in cartilage repair and remodeling" pps
... (5'→3') 0. 9 97 2 .05 GGCAAATTCAACGGCACA GTTAGTGGGGTCTCGCTCCTG Collagen IA 0. 9 97 2. 10 TGACTGGAAGAGCGGAGAGTACT CCTTGATGGCGTCCAGGTT Collagen II 0. 992 2.15 TTCCACTTCAGCTATGGCGA GACGTTAGCGGTGTTGGGAG ... Collagen III 0. 9 97 2 .05 CCCCGAGGGCTGTGCTA TGAACTTCAACTGGAACAGGGTATC Aggrecan 0. 992 2.15 TCTACCCCAACCAAACCGG AGGCATGGTGCTTTGACAGTG Collagen X 0. 992 1. 97 CACACTCTGTCCTCGTGCTTTG GGAATCCCTGTAAGACACACCAA ... were digested with chondroitinase ABC for hours at 37 C Then the sections were treated with 1% H2O2 in methanol for 20 minutes and subsequently washed with 0. 1% Triton X- 100 in PBS for minutes...
Ngày tải lên: 09/08/2014, 10:21
Tài liệu Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR pptx
... -1.22 0. 87 3.68 ** 0. 68 2. 50 * 1. 90 2.91 * 1.36 BEX1 3.25 5.69 7. 36 ** 3 .08 -0. 17 2.86 4 .72 * 5 .72 CDH1 1.85 3. 70 ** 1. 87 3.85 ** -0. 41 5. 20 0.48 -0. 70 CSTA 2.54 ** 4 .79 ** -1 .06 0. 80 0 .09 -1.93 ... -2. 87 -1.18 S 100 A2 -0. 70 -0. 02 4 .73 ** 0. 08 2.95 ** 1.66 -1 .01 4 .76 ** S 100 P 6.28 ** 8. 57 ** -0. 47 5 .00 6. 80 ** 0. 38 0. 39 0. 13 SLCO4A1 0. 13 2.92 2.81 1.52 4 .74 * 6. 67 ** 2.83 1 .78 STMN1 -1.44 1.41 ... -0. 59 0. 24 2.82 ** 0. 82 1.68 ** 3.24 ** 0. 49 2.81 ** IGSF3 5.61 ** 4.86 -0. 12 6.35 * 0. 19 1.28 4 .71 4.62 INADL 2.44 3. 70 2. 50 7. 65 ** 0. 48 1.48 0. 80 2. 30 ISL1 0. 31 -0. 45 0. 08 2.21 4.61 0. 10 -0. 74 ...
Ngày tải lên: 15/02/2014, 04:20
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... Med 205 , 2 97 318 Furuyama K & Sassa S ( 200 0) Interaction between succinyl CoA synthetase and the heme-biosynthetic enzyme ALAS-E is disrupted in sideroblastic anemia J Clin Invest 105 , 75 7 76 4 ... 63, 1 67 178 23 Ishikawa K, Takeuchi N, Takahashi S, Matera KM, Sato M, Shibahara S, Rousseau DL, Ikeda-Saito M & FEBS Journal 273 ( 200 6) 5333–5346 ª 200 6 The Authors Journal compilation ª 200 6 FEBS ... control) was determined with the Dual-LuciferaseTM Reporter Assay System (Promega, Madison, WI, USA) FEBS Journal 273 ( 200 6) 5333–5346 ª 200 6 The Authors Journal compilation ª 200 6 FEBS 5343 Heme oxygenase-2...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... in 1 50 lL of 50 mm KPB containing 0. 1% Triton X- 100 Each sample ( 300 lg of protein) was added to the standard reaction mixture of 200 lL, which contained 0. 1 m KPB (pH 7. 4), 15 lm hemin, 100 lgÆmL)1 ... immediately heated for 30 at 100 °C The mixtures without heating were used as a blank for measurement of FEBS Journal 273 ( 200 6) 3136–31 47 ª 200 6 The Authors Journal compilation ª 200 6 FEBS Y Zhang ... Journal 273 ( 200 6) 3136–31 47 ª 200 6 The Authors Journal compilation ª 200 6 FEBS Y Zhang et al Reduced expression of heme oxygenase-2 ( 100 UÆmL)1), and streptomycin sulfate ( 100 lgÆmL)1) For hypoxia...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx
... 20 40 60 80 100 102 100 Counts 20 40 60 80 100 101 B 100 104 24% Counts 20 40 60 80 100 100 103 Counts 20 40 60 80 100 102 Counts 20 40 60 80 100 101 gp1 80 Counts 20 40 60 80 100 9% Counts 20 ... 101 102 103 100 101 102 103 Counts 20 40 60 80 100 104 100 101 102 104 CD1d42 100 103 104 100 –Fe 12.2% 101 102 103 104 MHC-II –Fe 101 102 103 104 Counts 20 40 60 80 100 101 ICAM-1 101 102 103 ... 40 60 80 100 100 MHC-I Counts 20 40 60 80 100 A Counts 20 40 60 80 100 CD1d Counts 20 40 60 80 100 Counts 20 40 60 80 100 M Cabrita et al 100 104 100 +Fe 101 102 103 104 +Fe 25.3% 101 102 103 ...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
... the reflectron in the following ratios: 1 .00 0 (precursor ion segment), 0. 9 60, 0. 7 50, 0. 563, 0. 422, 0. 316, 0. 2 37, 0. 178 , 0. 133, 0. 100 , 0. 075 , 0. 056 and 0. 042 (fragment segments) Individual segments ... 10 ng (lane 8), 20 ng (lane 9), 50 ng (lane 10) , 100 ng (lane 11) or 200 ng (lane 12) of nonlabelled GT oligomer The two probes were added to the sample at the same specific activity ( 10 000 ... incubated with ng of [c-32P]-labelled GT probe (GT) in buffer ( 200 mM Tris/HCl, pH 7. 5, containing 7 50 mM KCl, 10 mM dithiothreitol, 50 lgÆmL)1 BSA) in the absence (lane 1) or in the presence of 10 ng...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Insulin/protein kinase B signalling pathway upregulates metastasis-related phenotypes and molecules in H7721 human hepatocarcinoma cell line pptx
... UnC was set at 100 % *P < 0. 05 compared with UnC; **P < 0. 01 compared with UnC; #P < 0. 01 compared with the Ins group, but P > 0. 05 compared with LY-29 400 2.UnC, Ins, LY29 400 2, LY29 400 2 + Ins, as ... H 772 1 cells treated with 15 lM LY29 400 2; LY29 400 2 + Ins, H 772 1 cells treated with both LY29 400 2 and insulin; Mock, H 772 1 cells transfected with pcDNA3 vector; AS-PKB, H 772 1 cells transfected with ... < 0. 01 compared with the UnC group; *P < 0. 05 compared with the UnC or Mock group; #P < 0. 01 compared with the Ins group, but P > 0. 05 compared with the LY29 400 2 group; ##P < 0. 01 compared with...
Ngày tải lên: 21/02/2014, 00:20