... data were reweighted after selecting the model to obtain better estimates of kinetic parameters The dosage regimen of ceftriaxone was also determined based on the kinetic data The priming (D) and ... Saini [15] reported a decrease in V of amikacin in febrile cow calves as compared to healthy subjects A marked during fever and other decrease in the values of V diseased conditions has also been ... buffalo calves It is not axiomatic to compute the dosage regimen of ceftriaxone to be used effectively in clinical practice for the treatment of mild to severe bacterial infections, without having...
Ngày tải lên: 07/08/2014, 18:21
... programming) and of a debugger (see the section called The debugger); these are often much more effective and time-saving 15 Chapter Aspects of debugging C and C+ + code There are some circumstances ... example in the previous section Another tool is Checker The Checker tool uses it’s own version of gcc, checkergcc to include boundary checks in your code It is probably better than Electric Fence, ... haven’t been rebuilt after a change that affects them Make sure you use a Makefile, and that it accurately reflects the dependencies involved in building your project See the section called An example...
Ngày tải lên: 21/01/2014, 06:20
Báo cáo y học: "Seroprevalence of hepatitis B and C virus in HIV-1 and HIV-2 infected Gambians" pps
... and HCV NS5RnB-TACCT GGTCATAGCCTCCGTGAAG GCTC [41] Gel purified PCR products were sequenced using primers specific for the 5′UTR (KF2 - TTCACGCAGAA AGC GTCTAG and 211-CACTCTCGAGCAC CCTATCAGGCAGT) ... especially in men in high-risk geographical areas, there is little documented evidence for sex-linked differences in HBV replication [45] In conclusion, we showed that the prevalence of HBV chronic ... CCTATCAGGCAGT) and NS5b (HCVN S5F2-TATGA TACC CGCTGCTTTGACTCG; HCVNS 5R 2c- CTGG TCATAGCCTCCGTGAAGGCTCTCAGG and HCVN S5 R2d-CTGGTCATAGCCTCCGTGAAGGCTCGTA GG Statistical Analysis HBV seroprevalence was determined...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo sinh học: "Comparative expression profiling of E. coli and S. aureus inoculated primary mammary gland cells sampled from cows with different genetic predispositions for somatic cell score" ppt
... time point zero and control cells and inoculated cells derived from the same cell culture, no differences regarding gene expression between the inoculated and control cells were expected at time ... represents one probe level model; the line within the square represents the changes in the expression level during time-course between inoculated and control cells; in the upper left corner the number ... reliable investigation of associated molecular and cellular functions Nevertheless, the observed effects of cell culture and pathogen challenge on gene expression in pbMEC clearly indicate the...
Ngày tải lên: 14/08/2014, 13:21
Bệnh do trực khuẩn e. coli và Cl. perfringens gây ra ở đà điểu, biện pháp phòng trị
... perfringens Bảng Kết x c định độ mẫn c m E. coli với số loại kháng sinh Kháng sinh Amikacin Amoxiclin Cefazolin Cefuroxime Ofloxaxin Clindamicin Colistin Lincomycin Neomycin Nofloxacin Rifampicin Streptomicin ... bình Cl perfringens mẫn c m với số kháng sinh nh Ofloxacin, Ceftriaxon, Rifampicin, Gentamicin, Amoxiclin, Nofloxacin - Phòng bệnh E. coli v Cl .perfringens đ điểu Amoxicilin, Colistin, Trimethoprim, ... perfringens Kết thu đ c trình b y bảng Bảng Kết tiêm kiểm tra đ c l c E. coli v Cl perfringens chuột bạch Chuột chết đ c l c Chuột chết đ c l c Cl E. coli perfringens Mẫu Số Số T.chết Số T.chết...
Ngày tải lên: 17/05/2015, 23:08
Xác định vai trò gây bệnh của vi khuẩn E.coli , C.perfringens trong hội chứng tiêu chảy ở lợn từ sơ sinh đến 60 ngày
... Adherence Enteropathogenic Escherichia coli Brain-heart infusion Cng s Colonial Forming Unit Edema disease Edema disease pathogenic Enterohaemorrhagic Escherichia coli Eosin Methylene Blue Agar ... Agar Enteropathogenic Escherichia coli Enterotoxigenic Escherichia coli Heamolysin Heamolysin Khỏng nguyờn Heat-Labile enterotoxin Nh xut bn Polymerase Chain Reaction Shiga-like toxin Shiga-like ... dng Lờn men ng TSI C perfringens Enterobacteriaceae R/Y/H2 S+ Lờn men ng Lactose + Lờn men ng Lactose - E coli Salmonella K pneumoniae Enterobacter aerogenes Edwardsiella Proteus Salmonella - 41...
Ngày tải lên: 06/11/2012, 11:22
Phân lập, xác định đặc tính sinh học của e coli,salmonella gây tiêu chảy cho lợn sau cai sữa nuôi tại tỉnh lào cai và biện pháp phòng trừ
... Clostridium perfringens DNA Deoxyribo Nucleic Acid DPF Delayed Permeability Factor E coli Escherichia coli EMB Eosin Methylen-Bleu EPEC Enteropathogenic E coli ETEC Enterotoxigenic Escherichia coli ... phân loại vi khuẩn E coli th nh loại sau: Enterotoxigenic E coli (ETEC), Enteropathogenic E coli (EPEC), Adherence Enteropathogenic E coli (AEEC) v Verotoxingenic E coli (VTEC) (Lê Văn Tạo, 1997a ... Tr c khuẩn Gram dơng Oxidase âm tính Lên men đờng KL đen DHL KL đỏ BG TSI C perfringens Enterobacteriaceae R/Y/H2S+ Lên men đờng Lên men đờng E coli K pneumoniae Enterobacter aerogenes Salmonella...
Ngày tải lên: 28/11/2013, 11:07
Quantification of vitamin e and ç oryzanol components in RiceGermandBran
... reduced pressure at room temperature until ethanol and methanol were removed followed by drying in a freeze-dryer The dry extracts (extractable phytochemicals) represented 24.8% of the rice germ ... Figure Structures of vitamin E and γ-oryzanol components examined in this study However, commercial rice bran is a mixture of rice bran and rice germ (20% of rice bran), and the difference in the ... components in the rice samples were determined using calibration curves of their corresponding standard The compounds were quantified by calibration curves of their structurerelated standards when their...
Ngày tải lên: 15/03/2014, 15:33
Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx
... described above, where kp and kn represent the first-order rate constants for the faster refolding phase of RNase T1 in the presence and absence of the enzyme, respectively Circular dichroism The ... at 50 C and E coli FKBP22* at 80 C were not seriously changed at higher temperatures, indicating that these spectra represent the spectra of these proteins in a denatured form In these conditions, ... dashed line) are shown The spectra were measured as described under Experimental procedures SIB1 FKBP22* at 10 C and E coli FKBP22* at 20 C, which represent the spectra of these proteins in a...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Redox-sensitive loops D and E regulate NADP(H) binding in domain III and domain I–domain III interactions in proton-translocating Escherichia coli transhydrogenase potx
... the single ecIII cysteine mutants, ecIIIA39 8C, ecIIIS40 4C, ecIIII40 6C, ecIIIG40 8C, ecIIIM40 9C, ecIIIV41 1C (loop D), and ecIIIY43 1C (loop E) , were expressed in the cysteine-free background and ... summarized in Table The severe effect of mutating this conserved glycine into a cysteine was clearly reflected in the resulting maximal rates of the reverse, forward and cyclic reactions which were all ... [19], were partly characterized previously In order to be able to react these with thiol-speci c reagents, all selected residues were mutated to cysteines in the cysteine-free E coli transhydrogenase...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo khoa học: "Production and purification of immunologically active core protein p24 from HIV-1 fused to ricin toxin B subunit in E. coli" ppt
... Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived ... Figure of recombinant proteins expressed in E coli and immunodetection Purification Purification of recombinant proteins expressed in E coli and immunodetection Purification was performed as described ... suggest that the chimeric protein retained heightened immunogenicity based on the adjuvant properties of the genetically linked RTB Indeed, the presence of RTB markedly enhanced immune responses...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: "Transfer of immunoglobulins through the mammary endothelium and epithelium and in the local lymph node of cows during the initial response after intramammary challenge with E. coli endotoxin" ppt
... be merely a result of diffusion while the transfer through the epithelium and the Ig concentrations in milk seemed to be more influenced by selective mechanisms and local sources, respectively ... Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and archived on PubMed ... additionally influenced by the content of afferent lymph flowing into the lymph node [8,30,31] Thus, the degree of influence from different sources can be expected to vary dependent on whether the node...
Ngày tải lên: 12/08/2014, 18:22
Báo cáo y học: "Dramatic increase of third-generation cephalosporin-resistant E. coli in German intensive care units: secular trends in antibiotic drug use and bacterial resistance, 2001 to 2008" pot
... coagulase-negative staphylococci, Enterococcus faecalis, Enterococcus faecium, Pseudomonas aeruginosa, Enterobacter cloacae, Citrobacter spp., Serratia marcescens, Acinetobacter baumannii, Stenotrophomonas ... be increasingly encountered in European ICUs, because it has been shown that high level carbapenemresistant KPC-producing bacteria may be selected during imipenem and meropenem therapy [31] In ... the median of carbapenem use and 3GC resistance in E coli Resistance started to increase in parallel in 2006, indicating that the increase was not only based on some outlier ICUs but affected almost...
Ngày tải lên: 13/08/2014, 20:22
Nghiên cứu vai trò của E. Coli, Salmonella, Clostridium Perfringens gây tiêu chảy ở lợn tại 3 tỉnh miền núi phía Bắc và biện pháp phòng trị
... coli (ETEC), Enteropathgenic E coli (EPEC), Adherence Enteropathogenic E coli (AEEC) Verotoxingenic E coli (VTEC) (Lê Văn Tạo, 1997) [44] Ngồi số chủng kh c khơng thu c nhóm c khả gây bệnh cho ... Unit : C ng : Clostridium perfringens : Deoxyribonucleic Acid : deoxyribonucleotide triphosphate : Escherichia coli : Enzyme Linked Immunosorbent Assay : Enterotoxine vi khn E. coli : Egg Yolk ... rRNA PCR S STA SIM T TAE TE TC TGC TGE TSC : Adenin : American Type Culture Collection : Brain Heart Infusion : base pair : Bình thường : Cytosin : Christie Atkins Munch Petersen : Colony Forming...
Ngày tải lên: 19/11/2014, 19:44
Nghiên cứu tác dụng diệt khuẩn in vitro của dịch chiết cây mò hoa trắng (clerodendrum fragrans vent ) đối với vi khuẩn e coli và salmonella spp phân lập từ phân lợn con theo mẹ bị tiêu chảy và thử nghiệm điều trị
... M C C C TỪ VIẾT TẮT Ký hiệu C c chữ viết tắt Ax Amoxicillin Am Ampicillin Ci Ciprofloxacin Kn Kanamycin Pn Penicillin E. coli Escherichia coli Sal Samonella Sta Staphylococus LB Luria Bertani ... Sulfadimethoxine, Tetracycline C c chủng vi khuẩn Salmonella c độ mẫn c m cao với Furazolidon (100%), Chloramphenicol (87,5%), mẫn c m với Penicillin (25%) hoàn toàn kháng lại Tetracyclin (Đỗ ... c t c dụng c chế phát triển vi khuẩn Pseudononas aeruginosa, Staphylococus aureus, Escherichia coli Proteus Theo tài liệu nư c ngoài, cuống lá, hoa rễ Xích đồng nam Clerodendrum kaempferi c ...
Ngày tải lên: 01/07/2015, 21:59
nghiên cứu tác dụng diệt khuẩn in vitro của dịch chiết lá cây huyền diệp (polyalthia longifolia var.pendula hort) trên vi khuẩn e.coli, salmonella spp phân lập từ phân chó tiêu chảy và thử nghiệm điều trị.
... streptomycin, gentamycin, kanamycin, amikacin, colistin, sulfamethoxazol/trimethoprim; kháng lại kháng sinh penicillin, neomycin, tetracyclin, doxycyclin, norfloxacin, ofloxacin Vi khuẩn Salmonella ... thu c kháng sinh Vi khuẩn E. coli kháng chủ yếu với nhóm cephalosporins, βlactams, tetracycline, spectinomycin, sulfonamides, chloramphenicol gentamicin (Sanchez S et al 2002) Ở Việt Nam, theo ... sinh, bao gồm ampicillin, chloramphenicol, streptomycin, sulphonamide tetracycline Theo nghiên c u Zhao c ng sự, chủng Salmonella enterica serotype Newport kháng lại loại kháng sinh (bao gồm cephalosporins)...
Ngày tải lên: 24/11/2015, 17:07