... single agents and in combination with rapamycin We found that asparaginase, sunitinib, and bevacizumab are effective as single agents, but not as effective as rapamycin Vincristine was not effective ... with Rapamycin Figure Asparaginase treatment improved survival and decreased tumor growth in nude mice bearing Tsc2-/- tumors (a) Average tumor volume over time for asparaginase and asparaginase ... of malignant cells and mTOR pathway activity in some tissues, L-asparaginase may be useful in treating TSC related tumors Vascular endothelial growth factor (VEGF) signaling is thought to play...
Ngày tải lên: 18/06/2014, 16:20
... hereby appoint said Mortgagee agent for the management of the Property, and the Mortgagee shall at any time and without notice have the right to enter upon, take possession of and manage the ... property, and observed that the overhead garage door was open and the door leading from the garage into the house was unlocked Olen secured the door from the garage into the house and placed a sign ... merely addresses what happens if legal action is filed ¶19 By signing the mortgage note and mortgage, the Hellers consented to Waterstone entering upon, taking possession of, and managing the...
Ngày tải lên: 15/03/2014, 10:20
A treatise on electricity and magnetism, vol i, j c maxwell
Ngày tải lên: 17/03/2014, 13:38
A treatise on electricity and magnetism, vol II, j c maxwell
Ngày tải lên: 17/03/2014, 13:38
Introduction to lagrangian and hamiltonian mechanics BRIZARD, a j
... transformation L → L+dF/dt on the Lagrangian itself, where F (q, t) is an arbitrary function We call L = L + dF/dt the new Lagrangian and L the old Lagrangian The Euler-Lagrange equations for ... derivative δL = d · mr dt = df , dt and, thus, can be eliminated from the system Lagrangian 38 CHAPTER LAGRANGIAN MECHANICS Figure 2.8: Motion on the surface of a cone 2.4.4 Lagrangian Mechanics ... ∂va/∂ q j = ∂ra/∂q j ∂va ∂ra − · j ∂q ∂q j U , (2.12) 2.3 LAGRANGIAN MECHANICS IN CONFIGURATION SPACE 27 Figure 2.3: Generalized coordinates for the pendulum problem 2.3 Lagrangian Mechanics in...
Ngày tải lên: 17/03/2014, 14:24
Quarks and leptons an introductory course in modern particle physics f halzem,a martin
Ngày tải lên: 17/03/2014, 14:38
majda a.j., kramer p.r. simplified models for turbulent diffusion.. theory, numerical modelling, and physical phenomena
... by Fannjiang and Papanicolaou [97] By carefully using the minimal and maximal variational principles in tandem, the e!ective di!usivity can be estimated in a fairly sharp manner for certain tractable ... notationally complex, formulas for o!-diagonal elements of K may be M found in [39] A similar Stieltjes integral representation was derived by Avellaneda and Vergassola [20] for spatio-temporal ... transport, pair dispersion, fractal dimensions of scalar interfaces, spectral scaling regimes, small-scale and large-scale scalar intermittency, and qualitative behavior over "nite time intervals...
Ngày tải lên: 24/04/2014, 16:48
báo cáo hóa học:" Identification of a public CDR3 motif and a biased utilization of T-cell receptor V beta and J beta chains in HLA-A2/Melan-A-specific T-cell clonotypes of melanoma patients" potx
... GCCAGCAGT G T .ACAGGGG CTCGG D/b GCCAGTAGTAT GACAGGG CTAGGG AGTGC GCCCGAT .ACAGGG CTTGGC GCCAGCAG ATACCA GGGAC TAGGA 39 GCCTGGAGTGT C C CAGGG CTAGG NA XXXXXXAGT CAT CAGGG ATTGGG 16 GCCAGCA ... D region N2 D /a GCCAGCAGTTTA CAGGGG CTGGGG 30 GCCTGGAGTGT .ACAGGGG CTGGGG GCCAGCAGCTT CACTGGGCT GGGG GCCAGCA TCTGGG CAGGG CTCGGG CGAAT CAGGGG CTCGGG 50B,55 17 TRBV TRBJ References 28 1–5 ... XXXXXXA a 82899S32 XXXXXX GGGCAAAT GGGGC TCGGG A/ 5 AGTGCTAG TGTGCC GGGGC TCGGG 25 GCCAGCAG ACA .ACAGGGG TTGGG CCCGGT .AGGG TTGGG 814S2 XXXXXXAG 82899S26 XXXXXXAGT C C CAGGGGGC TCGG 42 GCCAGCAGT...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo sinh học: " HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" potx
... CAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCA 6604m_969CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA ... CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA SspI r e c o g n i t i o n s i t e stop codon responding to 1763–1770 nt of the complete ... 5'GATCCATACTGCGGAACTCC3' (1263– 1282) and antisense 5'AGCTTGGAGGCTTGAACAGT3' (1859–1878) Genomic DNA was extracted from 200 µl of serum using the QIAamp DNA mini Kits (Qiagen® U.S .A. ) according...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo toán học: " Reconstructing subsets of reals A.J. Radcliffe 1 Department of Mathematics and Statistics" pdf
... the sets A ∩ J and B ∩ J are equal, from which it easily follows that A = B Consider then such a J If a + {0, r, α} ⊂ A then a ∈ XA and a + {0, r, α} ⊂ A ∩ J ⇐⇒ ⇐⇒ a+ α ∈ J α∈ J Since J is isomorphic ... then A B Proof Suppose A and B are locally finite subsets of with the same 3deck Let k be some distance that occurs in A, and again define XA = {a ∈ A : a + k ∈ A} and XB = {b ∈ B : b + k ∈ B} as ... to show that, except for a finite amount of confusion, we have S = A To this end, let N be sufficiently large such that for all distinct a, a ∈ A with |a| > N we have |a − a| > 4c and for all distinct...
Ngày tải lên: 07/08/2014, 06:20
Báo cáo toán học: "A note on polynomials and f -factors of graphs" docx
... subgraph where the degrees are in prescribed sets ˜ With this in mind, we define a partial f -factor of a graph G = (V, E) to be an f -factor of ˜(v) = f (v) ∪ {0} for all v ∈ V , and a partial f ... f -factor of G is non-trivial if it is G where f non-empty Our next result is a sufficient condition for a graph to have a partial f -factor: Theorem Let G = (V, E) be a graph, and let f satisfy ... multiples of p (this subgraph certainly need not be a spanning subgraph) For example, every 2p − 1-regular graph contains a p-regular subgraph when p is a prime power More generally, we can ask for a...
Ngày tải lên: 07/08/2014, 15:22
Báo cáo toán học: "On a Conjecture of Frankl and F¨redi u" doc
... number of discussions with Eva Czabarka, Ida Kantor, Gyula O.H Katona, Nathan Lemons, Bal´zs Patk´s, a o L´szl´ Sz´kely, and Jacques Verstra¨te The author thanks the NSF for funding her and a o e ... counting pairs (x, {F1 , F2 }) such that {F1 , F2 } ⊂ F and x ∈ F1 ∩ F2 We now assume λ ≥ and F ⊂ X is also k-uniform, and prove that |∂ F | = m k if and only if F is a symmetric design Ryser ... 2-intersecting family of size m and F = F , then (1.1) holds Frankl and F redi [7] showed (1.1) holds for all non-trivial 1-intersecting families using u an argument similar to that of de Bruijn and...
Ngày tải lên: 08/08/2014, 14:22
Báo cáo y học: "F-18 fluorodeoxyglucose positron emission tomography and/or computed tomography findings of an unusual breast lymphoma case and concurrent cervical cancer: a case report" docx
... [11] For extranodal disease, PET/CT and contrast-enhanced CT had a sensitivity of 88% and 50%, and a specificity of 100% and 90% [11] The degree of FDG uptake can distinguish indolent from aggressive ... case of concurrent breast lymphoma and cervical cancer FDG PET/CT has advantage over other imaging modalities because of its whole-body scanning that offers detection of metastasis and any previously ... case report shows a breast lymphoma case of a patient with a metastatic pattern similar to that of typical metastatic breast carcinoma Also, the FDG PET/CT scan diagnosed an extremely rare case...
Ngày tải lên: 11/08/2014, 07:20
Báo cáo y học: "Response of the mouse lung transcriptome to welding fume: effects of stainless and mild steel fumes on lung gene expression in A/J and C57BL/6J mice" pot
... the A/ J strain and contained a large number of upregulated genes such as C13ORF15, LRG1, LCN2, MMP12 and SAA2 (Table 4) Furthermore, at 16 weeks cellular growth and proliferation was an important ... Perhaps the most intriguing finding regarding GMA-MS welding fume Page of 18 exposure was the differential expression of behavioral genes associated with circadian rhythm signaling Most notably, ... associated categories of diseases and disorders, molecular and cellular functions and physiological system development and functions for A/ J and B6 mice and 16 weeks post-exposure to GMA-MS and...
Ngày tải lên: 12/08/2014, 11:22
Some observations of the effects of time on the capacity of piles driven in sand R. J. JARDINE, J. R. STANDING and F. C. CHOW†
... material, sand mineralogy and groundwater ionic concentrations Fig Original database of pile capacity against time in terms of: (a) total pile capacity; (b) shaft resistance alone pile-driving analysis ... ne sand m thick clay and peat layer near surface Alabama, USA Silty sand Jamuna Bridge, Loose to medium Bangladesh dense, silty, medium ne, micaceous sand Buckman Bridge Dense ne sand (BKM), Florida, ... responses after failure and unloading Extreme loading cycles, including pretesting to failure and subsequent unloading, degraded shaft capacity and disrupted the growth of capacity with time ( f )...
Ngày tải lên: 13/08/2015, 10:38
Báo cáo y học: "A review of anatomical and mechanical factors affecting vertebral body integrit
... psychosocial ramifications of fracture Vertebral fractures are a hallmark of osteoporosis and are associated with back pain, functional disability, reduced health-related quality of life and increased ... vertebral fracture Bone, macroscopic, local and global factors may interact to influence the risk of sustaining a vertebral fracture Cellular activity Trabecular architecture Subregional BMD ... while maintaining alignment of the vertebral column and has a primary role in attenuating and dispersing axial load With aging, the water content of the nucleus pulposus decreases, compromising the...
Ngày tải lên: 03/11/2012, 09:49
Editorial Stanley Publishing A To Zed or A To Zee - Grammar and Usage
... probably lead to a vote, (normal) Use of 'real' as an intensifier A TO ZED, A TO ZEE US GB That was a real nice meal That was a really nice meal He drives real fast In informal American English, ... usages Most of the differences we have mentioned are small and easily understandable in context, even if they sound amusing or quaint, as shan't and ought in the US, or as gotten and in back of ... staff, committee, company, firm, audience, family, team, etc., can take either a singular or a plural verb In American English such nouns usually take a singular verb The same is true of certain...
Ngày tải lên: 25/10/2013, 15:20
Hacking from a network: SYN flood and TCP Sequence number prediction attacks
... something goes wrong at this layer, at most, the IP layer will encapsulate part of the message in an ICMP packet and return it TCP Header - SYN Flag Frame Header Data Data IP Datagram Header Data TCP ... detection standpoint, these bogus packets that are assembled for the purpose of attacking and probing can be called crafted packets Quite often, the authors of software to craft packets make a small ... total length */ u_short ip_id; /* identification */ short ip_off; /* fragment offset field */ #define IP_DF 0x3000 /* dont fragment flag */ #define IP_MF 0x4000 /* more fragments flag */ u_char...
Ngày tải lên: 26/10/2013, 23:15
FTTX Architecture Creating a Cost Effective Plug-and-Play FTTX Architecture
... including thermal aging, temperature cycling, humidity aging, chemical exposure, UV radiation, salt fog and bacterial/fungus exposure Plug -and- play application Hardened connectors meeting OSP performance ... Cleaning techniques for these hardened connectors have also been simplified, enabling improved reliability and maintenance Kits are available with easy instructions and materials for cleaning hardened ... connectors and adapters To clean the connector and adapter, the dust caps and plugs are removed to expose the inner optical components The adapter can then be cleaned simply using a standard swab and...
Ngày tải lên: 27/10/2013, 00:15