roi analysis and a motor control task

... the average age of participants (20.60 years) and siblings (23.00 years) was higher than the average age of participants (16.18 years) and siblings (16.88) in this study Although adolescent and ... exam-ine adolescent-sibling discrepancies, raw and standard-ized difference scores were calculated The standardstandard-ized difference scores were calculated by subtracting the sib-ling’s standardized ... (e.g., warmth, intimacy, empathy) and negative (e.g., conflict, rivalry) features and can have a major impact on sibling’s lives and wellbeing (see [17] for a review) Social or observational learning

Ngày tải lên: 10/01/2020, 12:54

... from France, Denmark, United States of America, China, Netherlands, Thailand, Germany and Taiwan Province of China The average age of feed manufacturing companies was 7.6 years (maximum 15 years; ... fishmeal, poultry meal, meat & bone meal, blood meal, and soybean and canola oil seeds products In addition, wheat and feed additives are imported. • Traders are centered around Dong Thap and Can Tho Provinces. ... Delta, Viet Nam (©FAO/ Mohammad R Hasan).Cover design: Mohammad R Hasan and Koen H Ivens Trang 3FOOD AND AGRICULTURE ORGANIZATION OF THE UNITED NATIONS Rome, 2019 PAPER 648 and a review of regulatory

Ngày tải lên: 15/05/2020, 10:11

... houses and automobiles, as well as to pay for vacations Debt had become so widespread that by 2011, total debt as a percentage of annual economic output had risen above 300% for France, Italy, and ... Europeans can draw maximum benefit from it,” systemic change that sustainably incorporates both financial and human capital is necessary.xvii The European Union has the potential to serve as a model ... Ireland, pubs have long been a mainstay of communities both urban and rural They serve as social hubs, gathering places, and centers to experience and preserve arts, history and culture They may

Ngày tải lên: 13/01/2021, 16:35

... that they have all necessary expertise in the safety and regulatory ramifications of their applications, and acknowledge and agree that they are solely responsible for all legal, regulatory and ... sup-plies all the analog components necessary for voltage and current sensing, as well as a wide range of standard and advanced motor drivers TI understands the challenges developers face when ... order acknowledgment.TI warrants performance of its hardware products to the specifications applicable at the time of sale in accordance with TI ’ s standard warranty Testing and other quality control

Ngày tải lên: 21/10/2016, 10:48

... deformation of the MR skin and the elastic modulus of the MR skin surface material can imitate the characteristics of the human organ The initial pa-rameter and configuration are shown in Table 3and ... the real organs and also the displacement cal-culation, and Section 4 provides the optimization pa-rameters and the results configuration CONFIGURATION AND ANALYSIS MR skin configuration MR kin ... the or-gan based on palpation force and surface deformation aspects This device is designed to provide the user’s hand with realistic sensation through appropriate pal-pation force and surface deformation

Ngày tải lên: 12/01/2020, 02:25

... childrena The risk of high-birth-weight and SGA/AGA children compared to normal-birth-weight childrena LGA large for gestational age, SGA small for gestational age, AGA appropriate for gestational age ... gestational age, AGA appropriate for gestational age ORs and corresponding 95%CIs and p values were adjusted for sex, ethnicity, year of birth, age at diagnosis, gestational age (continuous variable), ... homogeneity = 0.279 SGA small for gestational age, AGA appropriate for gestational age, LGA large for gestational age Trang 8carcinogenic agents and therefore, the cancer risk in-creases after birth [32]

Ngày tải lên: 06/08/2020, 04:21

... IRF4 plays an important role in cancer pathogenesis and acts as a potential marker for haematological neoplasms and malignant melanoma [19,45] Recent GWAS findings have indicated that variants ... polymorphisms and cancer risk, we performed a meta-analysis of all available case-control studies Methods Literature search strategy We searched the PubMed and Web of Science databases for all relevant articles ... rs12203592 and rs872071 poly-morphism in the cases and controls Statistical analysis All statistical analysis was performed using STATA soft-ware (version 11.0; STATA Corporation, College Station,

Ngày tải lên: 14/10/2020, 17:08

... manuscript, supervised intraoperative radiation treatment and participated in data acquisition, statistical analysis and literature review BL participated in data acquisition, manuscript draft ... intraoperative radiation therapy physics PEH and JD revised the manuscript critically MB participated in data acquisition, statistical analysis and literature review, supervised external beam radiation ... manuscript draft and supervised surgical treatment TS participated in data acquisition, statistical analysis, literature review, medical treatment and drafting of the manuscript BK participated in protocol

Ngày tải lên: 05/11/2020, 00:29

... 103 Table D.1 Apparatus for experimental work 134 Trang 17xv LIST OF ABBREVIATIONS AI Artificial Intelligent ANN Artificial Neural Network AoA Angle of Attack AUV Autonomous Underwater Vehicle ... skeleton, and swimming modes were investigated in detail [1, 2] In another additional example, morphology, and hydrodynamic of natural fin-type as the tail fin, pectoral fins, dorsal fin, and anal fin ... This approach can attain great accuracy but much time consumption and high computational cost Meanwhile, the second approach (b) owns lower accuracy without time expenditure and low calculation

Ngày tải lên: 08/05/2021, 15:42

... 103 Table D.1 Apparatus for experimental work 134 Trang 17xv LIST OF ABBREVIATIONS AI Artificial Intelligent ANN Artificial Neural Network AoA Angle of Attack AUV Autonomous Underwater Vehicle ... skeleton, and swimming modes were investigated in detail [1, 2] In another additional example, morphology, and hydrodynamic of natural fin-type as the tail fin, pectoral fins, dorsal fin, and anal fin ... This approach can attain great accuracy but much time consumption and high computational cost Meanwhile, the second approach (b) owns lower accuracy without time expenditure and low calculation

Ngày tải lên: 16/06/2021, 22:05

... 103 Table D.1 Apparatus for experimental work 134 Trang 17xv LIST OF ABBREVIATIONS AI Artificial Intelligent ANN Artificial Neural Network AoA Angle of Attack AUV Autonomous Underwater Vehicle ... skeleton, and swimming modes were investigated in detail [1, 2] In another additional example, morphology, and hydrodynamic of natural fin-type as the tail fin, pectoral fins, dorsal fin, and anal fin ... This approach can attain great accuracy but much time consumption and high computational cost Meanwhile, the second approach (b) owns lower accuracy without time expenditure and low calculation

Ngày tải lên: 02/07/2021, 09:55

... 103 Table D.1 Apparatus for experimental work 134 Trang 17xv LIST OF ABBREVIATIONS AI Artificial Intelligent ANN Artificial Neural Network AoA Angle of Attack AUV Autonomous Underwater Vehicle ... skeleton, and swimming modes were investigated in detail [1, 2] In another additional example, morphology, and hydrodynamic of natural fin-type as the tail fin, pectoral fins, dorsal fin, and anal fin ... This approach can attain great accuracy but much time consumption and high computational cost Meanwhile, the second approach (b) owns lower accuracy without time expenditure and low calculation

Ngày tải lên: 03/07/2021, 22:59

... functions available in MATLAB for managing and handling arrays as listed in Table 2.17 36 ANALYSIS AND DESIGN OF CONTROL SYSTEMS USING MATLAB Table 2.17 Built-in functions for handling arrays Function ... command execution quit exit Quits MATLAB Same as quit 2.9 ARRAYS An array is a list of numbers arranged in rows and/ or columns A one-dimensional array is a row or a column of numbers and a two-dimensional ... encouragement, patience, and support provided by my family members: my wife, Sudha, my family members, Ravi, Madhavi, Anand, Ashwin, Raghav, and Vishwa who have also shared in all the pain, frustration,...

Ngày tải lên: 01/01/2014, 18:43

... loss rates, and average delays of web-browsing and data are based on both their instantaneous outage probabilities and the GBN ARQ mechanism Let us denote the average packet loss rates and average ... and (33) that the QoS performances are intertwined across both the data link and network layers That is, the outage probabilities, lengthened activity factors, packet loss rates, and delays are ... the packet loss rate and the average delay of a Pareto-on/Pareto-off distributed NRT traffic for CDMA systems 4.1 Go-Back-N ARQ Compared to the stop -and- wait ARQ, GBN is more efficient and easy to...

Ngày tải lên: 22/06/2014, 22:20

... of gradual transitions are detected For each candidate frame, an accumulated comparison A( i) = d(i, i + 1) is computed if A( i) > Tb and d(i, i + 1) < Ts , and the end frame of a gradual transition ... 1] and t ∈ [0, , duration − 1], HVR and duration are the height and the width of the VR, respectively, rx and r y are ratios of pixel sampling, and a and b are shifts on each frame Thus, according ... Guimar˜es, M Couprie, N J Leite, and A de A Araujo, a “Video transition sharpening based on flat zone analysis, ” in Proc IEEE-EURASIP Workshop on Nonlinear Signal and Image Processing—NSIP, Grado-Trieste,...

Ngày tải lên: 23/06/2014, 01:20

... MICA-210: CCTTTTTTTCAGGGAAAGTGC, CCTTACCATCTCCAGAAACTGC [22], and bioCCATGTTTCTGCTG(L)TGCTGCT; MICA-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: ... MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG [21], and bioCTCAGGAC(L)ACGCCGGATT For the MICA250 assay, a genotyping primer bioCTCCAGAG [L]TCAGACCTTGGC, differentiating between a paralogue ... validation studies within a second independent French Caucasian family cohort and a case -control cohort of German Caucasian origin Association analysis within the second and combined first and...

Ngày tải lên: 09/08/2014, 14:20

... data analysis and reviewed the manuscript RFV helped with the data analysis and reviewed the manuscript PB was the principal supervisor of the study and assisted with data analysis, cross validation ... performed the data analysis and the cross validation, wrote and prepared the manuscript for submission VD helped with the data analysis and cross validation and reviewed the manuscript BJD helped ... longevity and production traits in dairy cattle, which faces similar problems The two-step approach is a combination of survival analysis and a linear animal model In the first step, survival analysis...

Ngày tải lên: 14/08/2014, 13:21

... advantages are clearly explained Wildi also presents the two types of induction motors: “the squirrel cage induction motor and the “wound motor An explanation of the advantages and disadvantages ... Field-Orientated (FO) control such as the rotating and stationary reference frames, Clarke and Park transforms, PI controllers and PWM are extensively explained Bose also exemplifies some MATLAB models ... two-phase currents to generate a means of instantaneously controlling the torque and flux Field-orientated controllers require control of both magnitude and phase of the AC quantities and are,...

Ngày tải lên: 27/10/2013, 23:15

... analysis and control for dams 1-5 General Considerations All earth and rock-fill dams are subject to seepage through the embankment, foundation, and abutments Concrete gravity and arch dams are ... ground-water properties is available in an Atlas (Pettyjohn et al 1979) Sampling, sample preservation, and chemical analysis of ground water is covered in handbooks (Moser and Huibregtse 1976, and ... Schofield 1955 and Cary, Walter, and Harstad 1943) Available data indicate that cohesive soils may be two to three orders of magnitude more permeable to seepage water containing moderate amounts of...

Ngày tải lên: 28/04/2014, 11:51

... augmented with a neural prosthesis: A cross-over study Canadian Journal of Physiology and Pharmacology 2004, 82:749-756 Furuse N, Watanabe T, Ohba S, Futami R, Hoshimiya N, Handa Y: Control- Command Detection ... Delhi: Macmillan India; 2006 Kurosawa K, Futami R, Watanabe T, Hoshimiya N: Joint angle control by FES using a feedback error learning controller IEEE Transactions on Neural Systems and Rehabilitation ... algorithm are used to drive a neural controller which activates a biomechanical model of a simulated human arm and controls the FES To this purpose, and according to [36], a second ANN (ANN2 in...

Ngày tải lên: 19/06/2014, 10:20