rmm for methane conversion powered by a nuclear reactor

Tài liệu Báo cáo khoa học: "Three BioNLP Tools Powered by a Biological Lexicon" doc

Tài liệu Báo cáo khoa học: "Three BioNLP Tools Powered by a Biological Lexicon" doc

... Gratta, Yutaka Sasaki, Jock McNaught, Simonetta Montemagni, Monica Monachini, Nicoletta Calzolari, Sophia Ananiadou, BioLexicon: Towards a Reference Terminological Resource in the Biomedical ... A. C., G Divita, A. R Aronson, and A. T McCray 2003 UMLS Language and Vocabulary Tools In Proc of AMIA Annual Symposium 2003, p.798 Robertson, S.E., Walker S., Jones, S., HancockBeaulieu M.M., and ... retro-regulate This means that derivational relations of retro-regulate are not covered by the Specialist Lexicon 20 adverbal adjetivial Terminologies nominalization adverb adjective noun verb Derivational...

Ngày tải lên: 22/02/2014, 02:20

4 334 0
báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc

báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc

... peritoneal cavity is a common site of ovarian cancer presentation or recurrence usually accompanied by ascites [3] Massive ascites and the associated abdominal distention can cause anorexia, nausea, ... performed the statistical analysis, and drafted the manuscript AC participated in the study design and coordination TL participated in the analyses of the ovarian ascites fluid SA participated ... human H19 transcript was (5_-ACTGGAGACTAGGGAGGTCTCTAGCA) upstream and (5_-GCTGTGTGGGTCTGCTCTTTCAAGATG) downstream The polymerase chain reaction (PCR) was carried out for 30 cycles (98°C for 15 sec,...

Ngày tải lên: 18/06/2014, 15:20

11 560 0
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx

Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx

... the RNA STAT-60TM Total RNA/mRNA isolation reagent, according to the manufacture’s instructions The RNA was treated by RNAse-free DNAse I to eliminate any contaminating DNA Total cDNA was synthesized ... areas was calculated for each group The Mean and SD of bladder tumor area (A) and weight (B) are shown Amit and Hochberg Journal of Translational Medicine 2010, 8:134 http://www.translational-medicine.com/content/8/1/134 ... activation was reported as a major mechanism for the IGF2 overexpression in a variety of tumors including bladder carcinoma, hepatocellular carcinoma, breast cancer, ovarian cancer and prostate cancer...

Ngày tải lên: 18/06/2014, 16:20

18 746 0
A DISTRIBUTED WATER QUALITY TANK MODEL FOR NITROGEN LOAD REDUCTION BY ARTIFICIAL WETLANDS

A DISTRIBUTED WATER QUALITY TANK MODEL FOR NITROGEN LOAD REDUCTION BY ARTIFICIAL WETLANDS

... Verification at point A every 10 with rainfall SCENARIO ANALYSIS FOR NITROGEN LOAD REDUCED BY ARTIFICIAL WETLANDS Scenario analysis The TN concentration at point A is calculated for artificial wetlands ... use and drainage data were added to each cell and were determined by means of a field investigation by using a land-use map and a 1:5,000 map (Fig 3) The Geographical Survey Institute in Japan ... The data measured at point A are illustrated in Fig Data for October 2001 and April 2002 are unavailable due to machine trouble The TN and NO3-N concentrations were diluted by rainfall TN mainly...

Ngày tải lên: 05/09/2013, 09:08

8 553 0
A Business and Co-operative Future For Weaver Street Market By Geoffrey Gilson docx

A Business and Co-operative Future For Weaver Street Market By Geoffrey Gilson docx

... need And that management manages by managing, not by collective discussion and action I would say that management has its own imperatives that are not the same as workers’ And that while we are ... from management, and management separate from worker, and worker separate from owner, and owner separate from customer – and then back again! We are all organically linked, in relationships that ... Whether as a lawyer (litigation, commercial and divorce) A speechwriter (for the national campaigning unit of a British political party; and for Michael Dukakis, Democratic Presidential Candidate...

Ngày tải lên: 06/03/2014, 14:21

83 339 0
For Young Women Only by Shaunti Feldhahn and Lisa A. Rice potx

For Young Women Only by Shaunti Feldhahn and Lisa A. Rice potx

... tons of research and data gathering about men that no one had done before Turns out, her Harvard graduate degree and years as a Wall Street analyst helped pave the way for these well-researched books! ... Lisa: To Sarah and Hannah—beautiful daughters and delightful friends, and Brandon a great young man in training From Shaunti: To a wonderful young lady and little laddie, who in a few short years ... that the answer is yes—and that this one fact creates a bunch of ideas for you to think about, as a girl…and down the road, as a woman RESPECT VERSUS LOVE Just after college, I (Shaunti) watched...

Ngày tải lên: 14/03/2014, 18:20

35 320 0
Báo cáo khoa học: "An Automatic Method for Summary Evaluation Using Multiple Evaluation Results by a Manual Method" pptx

Báo cáo khoa học: "An Automatic Method for Summary Evaluation Using Multiple Evaluation Results by a Manual Method" pptx

... 419–426 Kenji Yasuda, Fumiaki Sugaya, Toshiyuki Takezawa, Seiichi Yamamoto and Masuzo Yanagida 2003 Applications of Automatic Evaluation Methods to Measuring a Capability of Speech Translation System ... Kernel-based Approach for Automatic Evaluation of Natural Language Generation Technologies: Application to Automatic Summarization Proceedings of HLTEMNLP 2005: 145–152 As evaluation scores by Yasuda’s ... How many summaries, and what type (variety) of summaries should be prepared? Kazawa et al prepared summaries for each document, and Yasuda et al prepared 29 translations for each conversation...

Ngày tải lên: 17/03/2014, 04:20

8 360 0
Báo cáo khóa học: Hydrolytic cleavage by a group I intron ribozyme is dependent on RNA structures not important for splicing pot

Báo cáo khóa học: Hydrolytic cleavage by a group I intron ribozyme is dependent on RNA structures not important for splicing pot

... certain receptor motif, but with a significant cross reaction [24,25] Here, GUGA, GUAA and GAAA tetra-loops preferentially interact with CU:AG, CC:GG and a 11 nt motif, respectively To test for a ... urea/5% polyacrylamide gels, followed by autoradiography Computations To quantify RNA signals, phosphoimager screens were scanned after one to several days of exposure and the resulting images ... order to evaluate the rate of hydrolytic cleavage 17 catalyzed by DiGIR2 and DiGIR2DP9.2, we included the Tetrahymena ribozyme (Tth.L1925) in a comparative Ó FEBS 2004 analysis RNA obtained from...

Ngày tải lên: 23/03/2014, 12:20

10 414 2
A Search for Antibacterial Agents Edited by Varaprasad Bobbarala pptx

A Search for Antibacterial Agents Edited by Varaprasad Bobbarala pptx

... Myricana elegans Myricana elegans Carophora coronata Lantana camara Lantic acid (57) Lantana camara 22β-Acetoxylantic acid (58) Lantana Camara Taraxast-20-ene-3β-ol (59) Lupeol (65) Saussurea petrovii ... steroids Austroplenckia populnea Aquilaria agallocha Triterpenes Azadirachta indica Azima tetracantha Calophyllum inophyllum Cardiospermum helicacabum Cedrus deodara Triterpenes, alkaloids, anthraquinones, ... 1992 Takechi & Tanaka, 1992 Takechi & Tanaka, 1992 Takechi & Tanaka, 1992 Hichri et al., 2003 12 A Search for Antibacterial Agents Compound Activity against Grampositive bacteria Activity against...

Ngày tải lên: 31/03/2014, 19:20

355 708 1
báo cáo sinh học:" Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia" potx

báo cáo sinh học:" Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia" potx

... school as well as those lost to attrition Annual attrition is calculated by measuring the size of each cadre before new hires multiplied by the workforce attrition rates for each cadre The annual ... determined that staffing targets could be reached by 2018 for each rate of attrition, graduation, and public sector entry rate achieved by 2010, as long as there is a large enough accompanying increase ... dramatically Adequate preparation in primary and secondary education becomes even more crucial in the preparation of a good supply of eligible and qualified applicants We also assume the MOH has...

Ngày tải lên: 18/06/2014, 17:20

10 429 0
Báo cáo hóa học: "Probabilistic approach to modeling lava flow inundation: a lava flow hazard assessment for a nuclear facility in Armenia" pdf

Báo cáo hóa học: "Probabilistic approach to modeling lava flow inundation: a lava flow hazard assessment for a nuclear facility in Armenia" pdf

... flanks of Aragats include Tirinkatar, which is separated into two individual trachybasalt flows Tirinkatar-1 and Tirinkatar-2, and the Ashtarak lava flow Tirinkatar-1 and Ashtarak each have volumes ... assumes that each cell inundated by lava retains or accumulates a residual amount of lava The residual must be retained in a cell before that cell will pass any lava to adjacent cells This Page ... central portion of the lava flow simulation area) comprising lava flows from Shamiram, Atomakhumb, Dashtakar, Blrashark, and Karmratar volcanoes The ANPP site (black box) is located on the Shamiram...

Ngày tải lên: 21/06/2014, 19:20

19 357 0
Báo cáo hóa học: "Fabrication of Densely Packed AlN Nanowires by a Chemical Conversion of Al2O3 Nanowires Based on Porous Anodic Alumina Film" potx

Báo cáo hóa học: "Fabrication of Densely Packed AlN Nanowires by a Chemical Conversion of Al2O3 Nanowires Based on Porous Anodic Alumina Film" potx

... should also be evaporated at the converting temperatures of 1,300–1,400 °C And the evaporated aluminum can react with alumina nanowires, and may result in the formation of highly-active Al2O nanowires, ... aluminum, and thus gives a larger diameter of the AlN nanowires than that of the Al2O3 ones Summary and Conclusions Fig FE-SEM image of close-packed AlN nanowires obtained by chemical conversion ... with a uniform diameter and a pore interval Its average pore diameter and interval are *60 and 120 nm, respectively Significantly, a simple chemical etching of the porous alumina film in NaOH solution...

Ngày tải lên: 21/06/2014, 20:20

4 271 0
Báo cáo y học: "FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data" pdf

Báo cáo y học: "FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data" pdf

... of each primer (forward, TMPRSS2 exon - TAGGCGC GAGCTAAGCAGGAG; reverse, ERG exon GTAGGCACACTCAAACAACGACTGG; as published by Tomlins et al [23]) and 50 ng cDNA at an annealing temperature (Ta) ... TMPRSS2 and ETS transcription factor genes in prostate cancer Science 2005, 310:644-648 Soda M, Choi YL, Enomoto M, Takada S, Yamashita Y, Ishikawa S, Fujiwara S, Watanabe H, Kurashina K, Hatanaka ... Souza SJ, Galante PA, Busam D, Leversha MA, Chadalavada K, Rogers Y, Venter JC, Simpson AJG, Strausberg RL: Transcriptome-guided characterization of genomic rearrangements in a breast cancer cell...

Ngày tải lên: 09/08/2014, 22:23

19 522 0
Báo cáo y học: "Mitral valve surgery for mitral regurgitation caused by Libman-Sacks endocarditis: a report of four cases and a systematic review of the literature" pptx

Báo cáo y học: "Mitral valve surgery for mitral regurgitation caused by Libman-Sacks endocarditis: a report of four cases and a systematic review of the literature" pptx

... echocardiography papillary fibroelastoma usually arise via a pedicle from mitral valve tissue or adjacent endocardium, and have a characteristic frond-like appearance [31] A remarkable feature that LS ... GR: Association of antibodies against phospholipids with heart valve disease in systemic lupus erythematosus Lancet 1990, 335:1541-4 Takayama T, Teramura M, Sakai H, Tamaki S, Okabayashi T, Kawashima ... organization, neovascularization, occasional haematoxylin bodies, and by a variable extent of inflammation with mononuclear cell infiltration [6,7] Valvular lesions change over time [10] and...

Ngày tải lên: 10/08/2014, 10:20

13 587 0
Báo cáo y học: " A method for studying decision-making by guideline development groups" potx

Báo cáo y học: " A method for studying decision-making by guideline development groups" potx

... from a broad thematic analysis of a subset of data, to extract data excerpts warranting further analysis Identifying areas of interest One key assumption made by the research team, on the basis ... stages 2a and 2b: the relevance of available theories and evidence is evaluated at stage 3a prior to application of these to the data excerpts identified at stage 2b In this way, data extraction ... illustrates the potential both for innovation by synthesis in qualitative analysis, and for qualitative methods to be flexible and adaptable to research demands Page of (page number not for citation...

Ngày tải lên: 11/08/2014, 05:21

9 408 0
báo cáo khoa học: " A method for studying decision-making by guideline development groups" docx

báo cáo khoa học: " A method for studying decision-making by guideline development groups" docx

... from a broad thematic analysis of a subset of data, to extract data excerpts warranting further analysis Identifying areas of interest One key assumption made by the research team, on the basis ... stages 2a and 2b: the relevance of available theories and evidence is evaluated at stage 3a prior to application of these to the data excerpts identified at stage 2b In this way, data extraction ... illustrates the potential both for innovation by synthesis in qualitative analysis, and for qualitative methods to be flexible and adaptable to research demands Page of (page number not for citation...

Ngày tải lên: 11/08/2014, 16:20

9 244 0
Báo cáo khoa học: "Clinical significance of 4 patients with chronic hepatitis B achieving HBsAg clearance by treated with pegylated interferon alpha-2a for less than 1 year: a short report" pot

Báo cáo khoa học: "Clinical significance of 4 patients with chronic hepatitis B achieving HBsAg clearance by treated with pegylated interferon alpha-2a for less than 1 year: a short report" pot

... sequential therapy with pegasys and entecavir(Baraclude) Pegasys was administered at a dose of 180 ug intracutaneously one time per week Baraclude was administered at a dose of 0.5 mg orally one ... months Among them, serum HBV DNA was arrayed by fluorescent quantitative PCR and HBV markers were arrayed by ELISA Results Therapeutic efficacy Within less than year, serum HBV DNA loss, ALT normalization, ... help eradicate HBV infectious hepatocytes by dual anti-viral and immunomodulatory mode of action[10] In contrast to nucleoside analogues, pegylated interferon alpha- 2a has a higher rate of HBeAg...

Ngày tải lên: 12/08/2014, 04:21

3 328 0
Báo cáo y học: "Noninvasive positive pressure ventilation for respiratory failure caused by exacerbations of chronic obstructive pulmonary disease: a standard of care" ppt

Báo cáo y học: "Noninvasive positive pressure ventilation for respiratory failure caused by exacerbations of chronic obstructive pulmonary disease: a standard of care" ppt

... poor candidates for noninvasive ventilation, such as those who are in respiratory arrest, medically unstable otherwise, uncooperative, and unable to protect their airway or handle airway secretions ... respiratory failure, use of NPPV to facilitate weaning or to avoid extubation failure in non-COPD patients, and do-not-intubate patients Some of these applications may become standards of care as ... NPPV to treat patients with acute respiratory failure due to COPD exacerbations is accepted as a standard of care, then this means that a substantial minority of institutions in Europe, and undoubtedly...

Ngày tải lên: 12/08/2014, 19:22

3 239 0
Báo cáo y học: "Inhibition of HIV-1 integrase nuclear import and replication by a peptide bearing integrase putative nuclear localization signal" pot

Báo cáo y học: "Inhibition of HIV-1 integrase nuclear import and replication by a peptide bearing integrase putative nuclear localization signal" pot

... DraI site, to facilitate screening The primers used were: 152-IN: 5'-CCCGCAGTCTCAGGGTGTTGTTTAAACTATGAACAAAGAGCTC-3' 180-IN: 5'-CCGCGGTTCAGATGGCTGTTTAAACCACAA CAAGAAACG-3' Construction of plasmids ... by PCR amplification from pT7-7-180-IN The primers used were: 5'BsrGI: 5'-CCGCCATGTACAAAGAGCTCAAAAAAATCATCGGTCAG-3' BsrGI: 5'-GCGGTATGTACACCAGCAGAGTAACCACCGATAC-3' The resultant DNA products were ... supernatant was then centrifuged at 8000 g and separated into supernatant (cytoplasm) and pellet (nuclei) and stored at -70°C Quantitation of total and nuclear viral DNA Total viral DNA was estimated...

Ngày tải lên: 12/08/2014, 23:22

16 293 0
Báo cáo y học: "A nuclear export signal within the structural Gag protein is required for prototype foamy virus replication" pdf

Báo cáo y học: "A nuclear export signal within the structural Gag protein is required for prototype foamy virus replication" pdf

... GagF10 9A, GagL9 5A/ F9 7A and GagΔ95-112 mutants, which each showed a similar distribution as the G110V mutant, were further examined for release particle and infectivity (data not shown) and behaved as ... infection can be divided into an early (synthesis of Gag and its nuclear translocation) and late (nuclear export of Gag, capsid assembly and virus egress) phases [41] We show here that nuclear export ... appropriate antibodies before being detected by enhanced chemoluminescence (Amersham) Rabbit polyclonal anti-PFV Gag, rabbit polyclonal anti-actin (Sigma), and mouse monoclonal anti-LDH (Sigma) were...

Ngày tải lên: 13/08/2014, 01:20

11 255 0
w