... to favour a similar mode of binding for Ac-OPP and Ac-CoA Binding mode of CoA to thiolases oxidized or acetylated at Cys89 The structure of CoA-complexed Z ramigera thiolase, in which the catalytic ... Merilainen et al ¨ Table Calorimetric analysis of CoA binding to the Z ramigera biosynthetic thiolase at 25 °C The values and error estimates are calculated from separate measurements (three for ... interactions at the thiolase active site liquor, was allowed to continue for days prior to data collection This experiment was performed for both a wildtype thiolase crystal and a C8 9A mutant...
Ngày tải lên: 16/03/2014, 04:20
... IEEE-IA TRANSACTIONS paper published in mid-year 1994 to mid-year 1995, the IEEE-IAS Magazine Prize Article Award in 1996, the Class of 2001 Texas A& M University Faculty Fellow Award for demonstrated ... power rating, is the peak of input voltage, and is angular input frequency and input current I RATANAPANACHOTE et al.: DIGITALLY CONTROLLED SWITCH MODE POWER SUPPLY Fig 13 129 Proposed matrix ... Section V A commercially available matrix converter module: FM35R12KE3 from EUPEC [6] was employed A digital signal processor (TMS320LF2407) was used for generating PWM gating signals and performing...
Ngày tải lên: 13/05/2014, 00:55
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... pGL3b:Prm3ac & pGL3e:Prm3ac (Primer Kin188; 5¢-dGAGAGGTACCGAATTAATCACAAGCAA ATCTTCTC-3¢, corresponding to NTs )119 to )94) (7) Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC ... Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC-3¢; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and pGL3e:Prm3aOCT)1*, OCT)1 * pGL3e:Prm3ab Mutation ... generating pGL3b:Prm3AP)1*, pGL3e: Prm3AP)1*, pGL3b: Prm3aAP)1*, pGL3e:Prm3aAP)1*, pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b: Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1*...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx
... peroxisomal aspartate aminotransferase Aat2p in HPLC fraction at a molecular mass of approximately 45 kDa (Fig 1A) [15] The predicted molecular mass of Lpx1p is 44 kDa It carries a peroxisomal targeting ... (AAC71532) and with the putative triacylglycerol lipase AAB96044 from Mycoplasma pneumoniae (Mp) Identical amino acids are indicated by an asterisk and similar amino acids are indicated by a colon and ... Hegemann, Dusseldorf, Germany) For ă construction of pUG36-LPX1 (GFP–LPX1), PCR-amplified YOR084w (primers 5¢-GAGGATCCATGGAACAGAACA GGTTCAAG-3¢ and 5¢-CGGAATTCTTACAGTTTTTGT TTAGTCGTTTTAAC-3¢) was...
Ngày tải lên: 07/03/2014, 05:20
REBUILDING AMERICA’S DEFENSES Strategy, Forces and Resources For a New Century doc
... military forces and resources to a viable American strategy, it, too, will fail Paradoxically, as American power and influence are at their apogee, American military forces limp toward exhaustion, ... the radical overhaul the Army needs accuracy and virtual impunity American air power has become a metaphor for as well as the literal manifestation of American military preeminence American landpower ... in military affairs to offset American advantages in naval and air power, for example If the United States is to retain the technological and tactical advantages it now enjoys in large-scale conventional...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... to Patthy [29] Splice donor Intron no (length; bp) Splice acceptor Phase of intron acag|gtaag tatg|gtaag tatg|gtaag agag|gtaag g(t)5aacag|aagaa c(t)4gtatacag|actc a( t)4cag|atcc c(t)4ag|aatc Not ... (5¢-CGGGATCCCAATCTGTTGCTAA TTAGG-3¢) and the 3¢ specific oligonucleotides (5¢-GA AGATCTACCACACCTCCTCATCTCC-3¢) for amplification of the region from )180 to )36 and (5¢-GAAGAT CTAACTAGATTTTACCATTGG-3¢) for amplification ... stranded oligonucleotides spanning the region from )70 to )36 of the xMGP promoter (5¢-GATCCAGGGGAGGGAAAACAAGGA GATGAGGAGGTGTGGT-3¢, and 5¢-GATCTACCA CACCTCCTCATCTCCTTGTTTTCCCTCCCCTG-3¢) as BamHI/BglII...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc
... activate it Active RPTPa-D2 is required for Src activation Materials and methods Materials and antibodies Anti-HA-tag (12CA5), anti-Src (327) Igs and anti-RPTPa (5478AP) serum were prepared as ... distinctive form of Noonan syndrome Nat Genet 39, 75–79 37 Razzaque MA, Nishizawa T, Komoike Y, Yagi H, Furutani M, Amo R, Kamisago M, Momma K, Katayama H, Nakagawa M et al (2007) Germline gain-of-function ... forward and reverse oligonucleotides: 5¢- ATG AAG AAG AAC CAT GTT TTA CAG ATC -3¢ and 5¢ - GAT CTG TAA AAC ATG GTT CTT CTT CAT - 3¢ The constructs encoding WT, R554H or C723S GST-PTPalpha D2...
Ngày tải lên: 15/03/2014, 10:20
Báo cáo khoa học: The b domain is required for Vps4p oligomerization into a functionally active ATPase potx
... 5¢-TTAAAAGAACCAGATTAGTCAATTGATTAACGTGCT-3¢ 5¢-AGCACGTTAATCAATTGACTAATCTGGTTCTTTTAA-3¢ 5¢-AAGCAAGAACAGTTCACTGCAGCTTTTGGTCAAGCAGGTAACTAGTCAATTGAT-3¢ 5¢-ATCAATTGACTAGTTACCTGCTTGACCAAAAGCTGCAGTGAACTGTTCTTGCTT-3¢ ... 5¢-GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG-3¢ 5¢-GGGCGGATCCTCTGCTTTTCTTTATC-3¢ 5¢-GCGCTAATGCAACCGTAGTCAATTGATTAACGTGCT-3¢ 5¢-AGCACGTTAATCAATTGACTACGGTTGCATTAGCGC-3¢ 5¢-TTAAAAGAACCAGATTAGTCAATTGATTAACGTGCT-3¢ ... 5¢-GCGCTAATGCAACCGATAGATGTCTCTACGGAGGAC-3¢ 5¢-GTCCTCCGTAGAGACATCTATCGGTTGCATTAGCGC-3¢ 5¢-GACGACGAAACAAGAAAAGATGGCGCCATCGAGATG-3¢ 5¢-CATCTCGATGGCGCCATCTTTTCTTGTTTCGTCGTC-3¢ 5¢-TGCTCTCCAGGTGATGATATTGAAGCTGATGAATTA-3¢...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: The Drosophila jumonji gene encodes a JmjC-containing nuclear protein that is required for metamorphosis pot
... were as follows: cycD-F, 5¢-GGGATCCCA CATTGTATTCG-3¢; cycD-R, 5¢-ACGGAGCTTTGAAG CCAGTA-3¢; cycE-F, 5¢-AAGGTGCAGAAGACGCA CTT-3¢; cycE-R, 5¢-AATCACCTGCCAATCCAGAC-3¢; cdk4-F, 5¢-TACAACAGCACCGTGGACAT-3¢; ... 5¢-TGGGCATCGAGACTATAGGG-3¢; rp49-F, 5¢-CGG ATCGATATGCTAAGCTG-3¢; and rp49-R, 5¢-GAACG CAGGCGACCGTTGGGG-3¢ Acknowledgements We would like to thank Haruki Shirato for providing the FLAG–mjmj plasmid and ... magnification of merged images of dJmj and DAPI staining showed that dJmj was localized mostly to bands, but it was also observed in interbands and at band–interband boundaries, and no correlation...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: A DNA-binding surface of SPO11-1, an Arabidopsis SPO11 orthologue required for normal meiosis docx
... [8–13] and Arabidopsis thaliana [14,15] Yeast, flies, nematodes and mammals encode a single SPO11; however, plants (e.g Arabidopsis and rice Oryza sativa) encode at least three SPO11 paralogues ... Agrobacterium-mediated transformation of Arabidopsis thaliana Plant J 16, 735–743 Supporting information The following supplementary material is available: Fig S1 Tests for biochemical activities of ... Methanococcus jannaschii (accession no.: AAB98358) are shown Amino acids that were conserved among at least six of the seven homologues are shaded in gray B vicinity of a basic surface (Fig 4A) ...
Ngày tải lên: 29/03/2014, 09:20
Báo cáo khoa học: Mediator is required for activated transcription in a Schizosaccharomyces pombe in vitro system potx
... binding domain, Gal4-AP2, Gal4-VP16 and GAL4-CTF The gene that encodes the Gal4-AP2 transcriptional activator, which contains the Gal4 DNA binding domain and an activation domain from the AP2 transcription ... 17 Naar, A. M., Beaurang, P .A. , Zhou, S., Abraham, S., Solomon, W & Tjian, R (1999) Composite co-activator ARC mediates chromatin-directed transcriptional activation Nature 398, 832 18 Naar, A. M., ... the largest subunit of RNAPII The RNAPII holoenzyme was also able to support transcriptional activation (at least fivefold, as measured with a Phosphoimager) by the mammalian Gal4-AP2 transcriptional...
Ngày tải lên: 30/03/2014, 14:20
jack, k. (2001). video demystified - a handbook for the digital engineer (3rd ed.)
... used for broadcast purposes) It is a set of two analog signals, one analog Y and one that carries the analog U and V information in a specific format (also called C or chroma) Once available ... -4 = = = = = 21 SAMPLE SAMPLE SAMPLE SAMPLE SAMPLE 16 BITS PER SAMPLE DATA DATA DATA DATA DATA Figure 3.4 4:2:2 Frame Buffer Formatting SAMPLE SAMPLE SAMPLE SAMPLE SAMPLE SAMPLE ACTIVE LINE NUMBER ... These equations are usually scaled to simplify the implementation in an actual NTSC digital encoder or decoder Note that for digital data, 8-bit YIQ and R´G´B´ data should be saturated at the and...
Ngày tải lên: 18/04/2014, 12:27
Báo cáo sinh học: " A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" pptx
... treated with DTT and NP40 to separate the envelope fraction from the core fraction and protein from each sample was separated by SDSPAGE and detected by Western blot with anti-I7L antisera As ... accumulation of immature viral particles, some with nucleoids, as well as the appearance of crescent shaped particles (Fig 4, panels D-F), similar to those observed by AnsarahSobrinho et al [5] Also ... panels A, B, D, E, and F represents 400 nm The bar in panel C represents 200 nm G1L are associated with the immature virus along with the accompanying DNA and other viral proteins, then activation...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Research Article A Simple Technique for Fast Digital Background Calibration of A/D Converters" potx
... compares our technique with other proposed techniques which address the same problem STANDARD DIGITAL BACKGROUND CALIBRATION A pipeline ADC is composed of a cascade of stages that perform an analog-to -digital ... receivers for different standards can be implemented on a single hardware platform In this situation, the input to the ADC is a narrowband signal, with no information content at dc, and occupies only a ... ADC with 14-bit nominal resolution, to calibrate the first stage where an error on the radix R has been forced Monte Carlo iterations have been performed for the parameter R varying in a suitable...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: " A Sigma-Delta ADC with Decimation and Gain Control Function for a Bluetooth Receiver in 130 nm Digital CMOS" pdf
... matching can be easily achieved without dramatically increasing unit capacitance Based on behavioral-level simulations, the minimum allowable capacitance value was chosen Six-phase clock signals ... for four years in the Audio/Multimedia Group, designing data converters for audio and multimedia applications Currently he works for the Nano-Meter Analog Integration Branch, as a Design Manager ... ADC has to work in the same substrate as the digital core, digital circuit noise coupling through the substrate and supply rails was carefully considered as an important design and layout parameter...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo hóa học: " A Digital Signal Processing Method for Gene Prediction with Improved Noise Suppression" ppt
... a value that approaches zero in a quadratic fashion as yT+G (p) approaches zero Noncoding regions in the window that have sample values less than Maxvalue are effectively suppressed Consider a ... can be interpreted as a bandpass digital filter operation followed by a decimation operation [2] The bandpass digital filter associated with the DFT method is centered at frequency 2π/3 and has ... [3] D Anastassiou, “DSP in genomics,” in Proc IEEE Int Conf Acoustics, Speech, Signal Processing, pp 1053–1056, Salt Lake City, Utah, USA, May 2001 [4] S Tiwari, S Ramachandran, A Bhattacharya,...
Ngày tải lên: 23/06/2014, 01:20
Báo cáo lâm nghiệp: "A digital photographic method for 3D reconstruction of standing tree shape" ppt
... method was validated against two independent datasets The first dataset contained a single tree which was measured 634 A. I Hapca et al Table I Characteristics of the four Norway spruce stands assessed ... horizontal distance between the camera and the tree was approximately 18.5 m Two images were taken for a particular tree and a compass was used to ensure that they were perpendicular to each other A ... field and laboratory measurements In the field, a digital camera (model Dsc-F505V, SONY Corporation, Japan) was mounted on a tripod and a spirit level used to ensure that the camera was orientated...
Ngày tải lên: 07/08/2014, 16:21
Báo cáo y học: "A nuclear export signal within the structural Gag protein is required for prototype foamy virus replication" pdf
... GagF10 9A, GagL9 5A/ F9 7A and GagΔ95-112 mutants, which each showed a similar distribution as the G110V mutant, were further examined for release particle and infectivity (data not shown) and behaved as ... appropriate antibodies before being detected by enhanced chemoluminescence (Amersham) Rabbit polyclonal anti-PFV Gag, rabbit polyclonal anti-actin (Sigma), and mouse monoclonal anti-LDH (Sigma) were ... (40 nM) GFP RevNES GFP + + GFP Merge C Gag WT Gag L9 5A Gag F9 7A Gag F10 9A Gag G110V Gag L9 5A/ F9 7A Gag 95 112 Gag RevNES 95LAFQDLDLPEGPLRFGPL112 A A A V AA LQLPPLERLTL N 28% 30% 35% 65% 77% 65%...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx
... ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, LOX1(reverse): CCTAGAGTCGCAGCAGCCAG, CD88(forward): TCAAGGTGGTGGTGGCAGTG, CD88(reverse): GTGACGATGGCTCCAGGAAGG, P21(forward): AGCAGCGGAACAAGGAGTCAG, ... electrophoresis as well as melt-curve analysis using the MyIQ system Primers used were (5' to 3'): β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): ... DNA microarray data and performed the statistical analysis AR conceived of the study, participated in its design, and wrote the manuscript All authors read and approved the final manuscript Acknowledgements...
Ngày tải lên: 13/08/2014, 09:20