... rectifier with active filtering function" , IEEJ SPC- 96 (107), 11-20 ( in Japanese) KataokaT, Murota 1, Fuse Y, Nakajima D and Nishikata S 1999, A Single-phase Voltage-Type P W Rectifier with the Function ... sinusoidal waveform in compliance with the sinusoidal reference signal and , that the current i has a nearly rectangular waveform due to the existence of a smoothing reactor Fig3(b) shows the waveform ... forphase v which is given by (11) can also be obtained in the same manner as that explained above for phase U EXPERIMENTAL INVESTIGATION To confirm the operation of the three-phase PWM rectifier with...
Ngày tải lên: 03/01/2014, 19:44
... C46 6A( sense) 5¢-GATAAA GCACCCGCTATCACAGACTGG-3¢; C46 6A( antisense) 5¢-CCAGTCTGTGATAGCGGGTGCTTTATCTG-3¢; C49 1A( sense) 5¢-GCAGAGAGCAAAGCCTATTTGAT AACAG-3¢ and C491(antisense) 5¢-TGTTATCAAATAG GCTTTGCTCTCTG-3¢ ... AGACTGGACACATGG-3¢ and 5¢-TCGGGCCATGGC ATGCCCGGGGGTCAGAGCTGGG-3¢ for amplification of D4 of GCSFR and 5¢-TACTCTCAAGAAATG CCCGGGTCCCATGCCCCAGAG-3¢ and 5¢-GCCCAG GATGATGTGTAGCTCCCCGGGCTCTGGGGTCAA GGT-3¢ for ... PCR reactions were: pSVL(sense) 5¢-GTGTTACTT CTGCTCT-3¢; pSVL(antisense) 5¢-TCTAGTTGTGGTT TGT-3¢; C45 8A( sense) 5¢-ATACTTGAGTGGGCTGTG TTATCAG-3¢; C45 8A( antisense) 5¢-ATCTGATAACAC AGCCCACTCAAGTAT-3¢;...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo khoa học: "A Functional Approach to Generation with TAG " pptx
... for associating TAG trees with the network traversal The traversal of a systemic g r a m m a r at a single rank establishes a set of functional choices that can be used to select a TAG tree The ... is a linguistic theory which states that a generated sentence is obtained as a result of a series of functional choices which are m a d e in a parallel fashion along several different functional ... Elhadad, M (1991) A contrastive evaluation of functional unification grammar for surface language generation: A case study in choice of connectives In C Paris, W Swartout, ~c W Mann (Eds.), Natural...
Ngày tải lên: 31/03/2014, 06:20
Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx
... subjects (CA genotype) was PCR amplified using a forward primer starting at nucleotide )622 (5¢-CCAAGACATACTAAGAATGG-3¢) and the same reverse primer ending at nucleotide +74 (5¢-GGCA GAGAAAACTCGAGAAC-3¢) ... nucleotides )132 and +74 (forward: 5¢-GAATGTGGGTCTCAGAGTTCC-3¢ and reverse: 5¢-GGCAGAGAAAACTCGAGAAC-3¢) were designed to generate a 206 bp 5¢ flanking DNA fragment For DHPLC analysis, PCR was performed ... EMSA data that demonstrate an allelespecific binding of nuclear factors and TFIID to the mutation containing sequence; ) 1A has less affinity than )1C Our novel data demonstrate that the )1C A mutation...
Ngày tải lên: 31/03/2014, 07:20
báo cáo hóa học:" Research Article Blow-Up Results for a Nonlinear Hyperbolic Equation with Lewis Function" potx
... utt −Au F u ,” Transactions of the American Mathematical Society, vol 192, pp 1–21, 1974 V K Kalantarov and O A Ladyzhenskaya, “The occurrence of collapase for quasi-linear equations of parabolic ... initial boundary value problem for a quasilinear parabolic equation with a generalized Lewis function which depends on both spacial variable and time He obtained the blowup of solutions with ... concavity method and showed that solutions with negative initial energy blow up in finite time This method was later improved by Kalantarov and Ladyzheskaya to accommodate more general cases Very recently,...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " Research Article On Stability of a Functional Equation Connected with the Reynolds Opera" docx
... Isac, and Th M Rassias, Stability of Functional Equations in Several Variables, vol 34 of Progress in Nonlinear Differential Equations and Their Applications, Birkh¨ user Boston, a Boston, Mass, ... Journal of Inequalities and Applications Banach algebra Ꮽ They have shown that if a mapping f : X → Ꮽ satisfies f (x ◦ y) − f (x) f (y) ≤ (3) with some > 0, then there exist a commutative C ∗ -algebra ... Boston, Mass, USA, 1998 [2] J Acz´ l and J Dhombres, Functional Equations in Several Variables, vol 31 of Encyclopedia of e Mathematics and Its Applications, Cambridge University Press, Cambridge,...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo y học: "A functional variant of Fcγ receptor IIIA is associated with rheumatoid arthritis in individuals who are positive for anti-glucose-6-phosphate isomerase antibodies" doc
... Pharmaceuticals, Osaka, Japan) was used for saturation (30 at 37°C) After two washes, sera (diluted 1/50) were added and the plates were incubated for 12 hours at 4°C After washing, alkaline phosphatase (AP)-conjugated ... consent was obtained from all participants Blood samples were collected from 187 Japanese patients with RA (mean age 46 ± 17 years; 33 females; mean disease duration 12.9 years [range 1–46 years]) ... patients with autoantibody related forms of RA, in particular the prevalence of those who have pathogenic autoantibodies that directly interact with FcγRs (especially FcγRIIIa) Anti-GPI antibodies are...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: " Alpha-1-antitrypsin deficient man presenting with lung function decline associated with dust exposure: a case repor" docx
... volume Author details 505 Parnassus Avenue, M1097, San Francisco, CA 94143, USA 21001 Potrero Avenue, San Francisco, CA 94110, USA 3350 Parnassus Avenue, Suite 609, San Francisco, CA USA Authors’ ... phenotype, with a quantified value of 24 U (normal ≥ 90 U) Treatment was initiated with a combination of inhaled fluticasone and salmeterol twice daily, tiotropium once daily and albuterol as needed Data ... of breath Although cigarette smoking is a well-established cofactor in airflow obstruction and emphysema among people with A1 AT deficiency, occupation has also been implicated as a risk factor...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: ": Colocalization of endogenous TNF with a functional intracellular splice form of human TNF receptor type 2." docx
... hp75TNFR staining is mainly found on the plasma membrane and in the Golgi apparatus, hicp75TNFR shows no plasma membrane staining and colocalizes with the Golgi apparatus and endosomal compartments ... hp75TNFR also appears as a faint band with about 50 kDa as already described earlier as a possibly differently glycosylated hp75TNFR species [34,35] A prominent double band was also stained in ... Inc (Santa Cruz, CA, USA) Secondary antibodies for immunostaining: rabbit anti-mouse FITC was from DakoCytomation GmbH (Hamburg, Germany), and goat anti-rabbit TRITC from Sigma-Aldrich Transfection...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: "Excessive substance use in bipolar disorder is associated with impaired functioning rather than clinical characteristics, a descriptive study" pdf
... interviewers were trained based on the training program at UCLA (CA, USA) and participated in regular diagnostic consensus meetings A good inter-rater reliability was achieved with an overall kappa ... participated in planning of the study, supervised the data collection and statistical analyses PAR, AOB, SL and IA participated in the data collection All authors have made substantial contributions ... 2007 69 American Psychiatric Association: Diagnostic and Statistical Manual of Mental Disorders Washington DC, USA: American Psychiatric Association 1994 70 Kay SR, Fiszbein A, Opler LA: The positive...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: "Inverse association of plasma IL-13 and inflammatory chemokines with lung function impairment in stable COPD: a cross-sectional cohort study" doc
... 350(26):2645-2653 Albertine KH, Soulier MF, Wang Z, Ishizaka A, Hashimoto S, Zimmerman GA, Matthay MA, Ware LB: Fas and fas ligand are up-regulated in pulmonary edema fluid and lung tissue of patients with acute ... 92(8):993-999 Takabatake N, Arao T, Sata M, Inoue S, Abe S, Shibata Y, Kubota I: Circulating levels of soluble Fas ligand in cachexic patients with COPD are higher than those in non-cachexic patients with ... K, Minatoguchi S, Asano K, Nishigaki K, Nomura M, Ohno A, Watanabe M, Sano H, Kumada H, Sawa T, Fujiwara H: An increase of soluble Fas, an inhibitor of apoptosis, associated with progression of...
Ngày tải lên: 12/08/2014, 15:21
Báo cáo y học: " Assessment of FIV-C infection of cats as a function of treatment with the protease inhibitor, TL-3" pot
... reactions using 5' primer MFIVCPL5' (5'-GATTTATAAATCATATG GCATATAATAAAGTGGGTACCACTACAACATTAG-3'), which adds an NdeI restriction site, methionine, and alkaline to the N-terminal of the protease ... 5'-TGTTAATGGATGTAATTCA TAACCCATC-3' Page 10 of 12 (page number not for citation purposes) Retrovirology 2004, 1:38 KAN forward: 5'-ACTGAACCTGACCGTACACGCTCAGGCGCAATCAC-3' KAN reverse: 5'-CCAGCCATTACGCTCGTCAT-3' ... Serologicals (Norcross, GA) The primer sequences used for real-time PCR are as follows: FIV reverse-transcriptase forward: 5'-ACTGAACCTGACCGTACAGATAAATTACAGGAA GAACCCCCATA-3' FIV reverse-transcriptase...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: " The reticulons: a family of proteins with diverse function" pptx
... 2007, 160:224-235 Iwahashi J, Kawasaki I, Kohara Y, Gengyo-Ando K, Mitani S, Ohshima Y, Hamada N, Hara K, Kashiwagi T, Toyoda T: Caenorhabditis elegans reticulon interacts with RME-1 during embryogenesis ... (NSF) and alpha/ beta soluble NSF attachment proteins (SNAPs) include the Pak-binding nucleotide exchange factor betaPIX J Cell Biochem 2006, 99:1203-1215 Wakana Y, Koyama S, Nakajima K, Hatsuzawa ... of ALS, however, this protein remains a possible candidate drug target for the disease [78] Lastly, RTN4 may have a role in multiple sclerosis and hereditary spastic paraplegia Autoantibodies against...
Ngày tải lên: 14/08/2014, 08:20
Investigation of SPR and electrochemical detection of antigen with polypyrrole functionalized by biotinylated single chain antibody a review
... Talanta 74 (2007) 308–317 8 H.Q .A Lê et al / Analytica Chimica Acta 674 (2010) 1–8 [3] A Ramanavicius, A Ramanaviciene, A Malinauskas, Electrochimica Acta 51 (2006) 6025–6037 [4] (a) C Richad, ... biotinylated single-chain antibody and the specific antigen Appendix A Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.aca.2010.06.008 ... formed with functionalized pyrrole, bearing an activated ester as linking agent for further modification, and pyrrole as spacer should have a large effect on the immobilization capacity of the antibody...
Ngày tải lên: 13/09/2015, 18:05
Tài liệu Báo cáo khoa học: A functional polymorphism of apolipoprotein C1 detected by mass spectrometry docx
... ethnic background of at least 1000 subjects was typical of the American Midwest with 90% of European ancestry and 5% each of African and Asian ancestry An exception was the targeted analysis ... fractions were pooled, and 20 lL was applied to one channel of an SDS ⁄ polyacrylamide gel with standard ApoC1 (CalBiochem, San Diego, CA, USA) in an adjacent channel Onedimensional SDS ⁄ PAGE ... of ApoC1 A functional importance of a methyl group side chain at position 45 was also suggested by homology alignment ApoC1 from six available species shows either Ala or Thr at the comparable...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... consumption was measured polarographically with a Clark oxygen electrode in metabolic chamber with a water jacket maintained at 37 °C (Hansatech, Norfolk, UK) Substrates, inhibitors, etc could be added ... membranes Anti-HA and anti-porin sera were used at : 5000 dilution whereas the anti-MWFE and anti-18 kDa sera were used at : 1000 dilution Horseradish peroxidase-conjugated secondary antibodies (anti-rabbit...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC-3¢; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and pGL3e:Prm3aOCT)1*, OCT)1 * pGL3e:Prm3ab Mutation ... generating pGL3b:Prm3AP)1*, pGL3e: Prm3AP)1*, pGL3b: Prm3aAP)1*, pGL3e:Prm3aAP)1*, pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b: Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* ... pGL3b:Prm3ax & pGL3e:Prm3ax (Primer Kin177; 5¢-dGAGAGGTACCAGCTACTTACACTGAAA TGCAG-3¢, corresponding to NTs )140 to )118) (6) Prm3ac; pGL3b:Prm3ac & pGL3e:Prm3ac (Primer Kin188; 5¢-dGAGAGGTACCGAATTAATCACAAGCAA...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes ... Saccharomyces cerevisiae D-arabinono-1,4-lactone oxidase (ALO), P54783; Candida albicans D-arabinono-1,4-lactone oxidase (ALO), O93852; Neurospora crassa, Q7SGY1; Gibberella zeae, XP_388870; Arabidopsis...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
... pH range from 5.3 to Tsuruga and Shikama [21] confirmed that the fast phase of oxidation was due to the a chains and the slow phase was due to the b chains Tsuruga et al found that the beta chain ... a water molecule which can then accelerate the displacement of the protonated superoxide anion, as was suggested by Tsuruga and Shikama [21] to explain the increase in oxidation rate of the a ... the auto-oxidation of Hb A0 has been the subject of several studies Mansouri and Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of the beta...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: "GAMR VIEWED AS A FUNCTIONING PART OF A COGNITIVES SERM A YTM" pot
... associated with a name, for instance, an a c t i v i t y value, is viewable from any spaces in which the name exists This means that any interpreted meaning associated with a name can only be evaluated ... l relevant grammatical information within a space or hypergraph called the grammar The associated interpretation functions for each grammatical type provide the interface with the pragmatic representation ... syntactic category aspect of each meaning of a phonetic word is also a part of the grammatical representation where i t makes associations with other syntactic categories The associations...
Ngày tải lên: 08/03/2014, 18:20