recovering storage cells from loss of a single disk

Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ were ... construction of the poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used...

Ngày tải lên: 30/03/2014, 13:20

10 696 0
Báo cáo y học: " Mixed infection and clonal representativeness of a single sputum sample in tuberculosis patients from a " docx

Báo cáo y học: " Mixed infection and clonal representativeness of a single sputum sample in tuberculosis patients from a " docx

... study, participated in its design, co-ordination and evaluation of data, and helped in drafting the manuscript All authors read and approved the final manuscript Additional material Additional File ... among hospitalised TB patients [12] Demographic data, including sex, age as well as date of diagnosis, clinical diagnosis, and treatment history, were obtained by review of medical and laboratory ... the analysis (Figure 1) All the study subjects were male, and the median age of the 198 patients with available age was 30 years (range, 20 to 63 years) Of these, 134 patients were new cases and...

Ngày tải lên: 12/08/2014, 16:20

10 404 0
Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

... Collinge AJ (1974) Occlusion of the septal pores of damaged hyphae of Neurospora crassa by hexagonal crystals Protoplasma 80, 57–67 19 Yuan P, Jedd G, Kumaran D, Swaminathan S, Shio H, Hewitt D, Chua ... (Kansas City, KS, USA) Plasmids and cloning procedures For heterologous expression in yeast, N crassa HEX1 was amplified from a N crassa cDNA library using PCR with primer pair RE951 (AAGAATTCATGGGCTACTACGA ... secondary antibodies applied were obtained from Molecular Probes (Alexa Fluor 594 goat anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse IgG) Acknowledgements We thank F Nargang for the N crassa...

Ngày tải lên: 23/03/2014, 07:20

10 351 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
báo cáo hóa học: " Psychometric properties of a single-item scale to assess sleep quality among individuals with fibromyalgia" potx

báo cáo hóa học: " Psychometric properties of a single-item scale to assess sleep quality among individuals with fibromyalgia" potx

... clinical trials During the baseline phase, study patients had to have an average daily diary pain score of at least (within the last days) on a numeric rating scale ranging from ("no pain") to ... medication up to and including Day1 If fewer than scores are available then baseline consists of all scores that are available Page of (page number not for citation purposes) Health and Quality of ... 1056 and 91.0% in study 1077) (Table 1) In study 1056, the mean age of patients was 48.8 years and the average duration of FM was years In study 1077, the mean age of patients was 50.1 years and...

Ngày tải lên: 18/06/2014, 18:20

7 597 0
báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pptx

báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pptx

... interpretation of the data and drafted the earlier versions of the manuscript BP made substantial contributions to the acquisition and analysis of the data and drafted the earlier versions of the manuscript ... to the analysis and interpretation of the data and drafted the earlier versions of the manuscript All authors gave final approval of the version to be published DJN and SBM made substantial contributions ... effect and escalating into more serious breakdowns is an essential characteristic of a reliable process It requires a focus on the adequacy of the organisational defenses that remain in reserve and...

Ngày tải lên: 20/06/2014, 04:20

7 444 0
báo cáo hóa học:" Neuronal transcription factor Brn-3a(l) is over expressed in high-grade ovarian carcinomas and tumor cells from ascites of patients with advanced-stage ovarian cancer" ppt

báo cáo hóa học:" Neuronal transcription factor Brn-3a(l) is over expressed in high-grade ovarian carcinomas and tumor cells from ascites of patients with advanced-stage ovarian cancer" ppt

... interpretation of data, drafting and revising the manuscript AL and CBR assisted with experiments, interpretation of data and manuscript preparation JFK and MAQ assisted in the interpretation of data ... high-grade ovarian carcinomas and tumor cells from ascites of patients with advanced-stage ovarian cancer Journal of Ovarian Research 2010 3:17 Submit your next manuscript to BioMed Central and take full ... Scientific, MA, USA) and re-probing the membrane with b-actin primary antibody (Sigma-Aldrich, Sydney, Australia) Statistical analysis Statistical analysis of the extent of Brn- 3a( l) immunostaining...

Ngày tải lên: 20/06/2014, 07:20

12 268 0
báo cáo hóa học:" Research Article Design and Implementation of a Single-Frequency Mesh Network Using OpenAirInterface" docx

báo cáo hóa học:" Research Article Design and Implementation of a Single-Frequency Mesh Network Using OpenAirInterface" docx

... channel measurements which can be used for channel characterization and capacity analysis [2] Apart from a general overview of OpenAirInterface, in this paper we present OpenAirMesh a specification ... to transport data traffic corresponding to a particular flow Table 4: Transport and physical channels Each of the transport channels is mapped to a corresponding physical channel of the same name ... stream the STF parser also performs fast antenna cycling, that is, every subcarrier is transmitted from a different antenna This way each stream can access all the degrees of freedom of the channel...

Ngày tải lên: 21/06/2014, 18:20

16 769 0
Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

... five Si layers (200 Si atoms) and a *12 A vacuum layer The bottom of the slab has a bulk-like structure with each Si atom saturated by an H atom All atoms except for the H and Si atoms at the bottom ... densities of the clean Si substrate, 19H-Si(111)- and isolated H atoms are calculated with the same lattice parameters and atomic positions as the relaxed Ag adsorbed 19H-Si(111)-7 surface This allows ... calculated by subtracting Figs 2c and 3b from Fig 3a in the plan determined by H atoms, absorbed Ag atom, Si corner adatom and the rest atom Figure 3c reveals that the charge depletion and accumulation...

Ngày tải lên: 22/06/2014, 00:20

6 369 0
Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

... approach to band gap calculation is not particularly accurate for polydisperse solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band ... containing solvents are used As it was indicated by Efrima et al [24], Lewis base alkylamine solvents promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates ... indirect-gap materials Values of the optical band gap for the samples were obtained by the extrapolation of the linear region of the plot of (ahv)1/2 against photon energy (hv) as shown in Fig 4(c) Clearly,...

Ngày tải lên: 22/06/2014, 22:20

5 365 0
The Integration of Functions of a Single Variable, by G. H. Hardy pptx

The Integration of Functions of a Single Variable, by G. H. Hardy pptx

... either algebraical or the sum of an algebraical function and of a finite number of constant multiples of logarithms of algebraical functions All algebraical functions which occur in the integral are ... Integrals of algebraical functions in general 38 11–14 The general form of the integral of an algebraical function Integrals which are themselves algebraical 38 15 Discussion of a particular case 45 ... operations which are always practicable And it has been shown, more generally, that we can always determine by means of such operations whether the integral of any given algebraical function is algebraical...

Ngày tải lên: 28/06/2014, 19:20

86 265 1
Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx

Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx

... and with compact colonies in soft agar The growth properties of these three bacteria obtained from the original outbreak had already been described [15] According to studies of Abdulmawjood and ... Isrina Oktavia Salasia et al reactions and with a commercial grouping kit (Slidex Strepto-kit bioMerieux, Nürtingen, Germany) The growth pattern of the bacteria in fluid media and the morphology of ... investigation of specimen from healthy and diseased humans, pigs and monkeys and also from other animals might elucidate the possibly existing epidemiological relation Acknowledgment The support of Alexander...

Ngày tải lên: 07/08/2014, 18:20

3 314 0
Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

... levels Anti-tetanus and anti-pneumococcal (Danish serotypes 2, 6B, 8, 9V, 14, 19F and 23F) antibody titers were measured by ELISA at 14 and 28 days after vaccination by a central laboratory Abatacept ... days after vaccination (μg/ml) 28 days after vaccination (μg/ml) N /A N /A N /A N /A N /A 28.6 (26) Group C (vaccines weeks after abatacept) N /A 12.5 (19) 6.1 (20) Group D (vaccines weeks after abatacept) ... Finally, as a normal humoral response to T-cell-dependent antigens peaks at around weeks [12], we also analyzed the impact on humoral response of the timing of vaccination relative to abatacept...

Ngày tải lên: 09/08/2014, 10:20

11 417 0
Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

... Genet A 2003, 11 7A: 136-142 20 Miyamoto Y, Mabuchi A, Shi D, Kubo T, Takatori Y, Saito S, Fujioka M, Sudo A, Uchida A, Yamamoto S, Ozaki K, Takigawa M, Tanaka T, Nakamura Y, Jiang Q, Ikegawa S: A ... Nishimura G, Kawabata H, Yokoyama H, Yoshida A, Tominaga S, Nagano J, Shimizu A, Wakana S, Gondo Y, Noda T, Shiroishi T, Ikegawa S: A novel dominant-negative mutation in Gdf5 generated by ENU mutagenesis ... Yanamandra N, Goodman FR, Mendoza-Londono JR, Savarirayan R, White SM, Graham JM Jr, Gale RP, Svarch E, Newman WG, Kleckers AR, Francomano CA, Govindaiah V, Singh L, Morrison S, Thomas JT, Warman...

Ngày tải lên: 09/08/2014, 13:22

5 447 0
Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx

Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx

... optimal anaesthetic and surgical strategies are to be taken into consideration Anaesthetic strategies Multidisciplinary team approach and close collaboration with the anaesthetist, is required Page ... lobectomy years ago CP: carinal plasty with reinplantation of the right main bronchus to the trachea for Tracheal Sarcoma (TS) or carcinoid tumor A: Alive D:Dead The postoperative mortality was 12.5% ... alignment and drafted the manuscript and VY participated in its design and coordination The authors read and approved the manuscript Author Details 1Cardiothoracic Department, Royal Victoria Hospital,...

Ngày tải lên: 10/08/2014, 09:22

7 314 0
báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps

báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps

... bacterium was stimulated by aspartate Dashed lines show bacterial division points after 80 of stimulation by aspartate, localized Tar was diffused completely Then, the aspartate was removed from ... It also suggests a possibility that change of Tar localization can be inherited by descendant cells and this can affect their motility and therefore their phenotype This assay can potentially ... bacterial chemotaxis: receptor dimers in signalling arrays Molecular Microbiology 1998, 30:459-466 Manson MD, Armitage JP, Hoch JA, Macnab RM: Bacterial locomotion and signal transduction J Bacteriol...

Ngày tải lên: 11/08/2014, 00:22

4 167 0
Báo cáo y học: " Osteolytic bone destruction resulting from relapse of a testicular tumour 23 years after inguinal orchiectomy and adjuvant chemotherapy: a case report" pot

Báo cáo y học: " Osteolytic bone destruction resulting from relapse of a testicular tumour 23 years after inguinal orchiectomy and adjuvant chemotherapy: a case report" pot

... 5th and 10th year after primary treatment with a calculated annual risk of 1% In two patients, late relapse occurred later than 10 years One of these patients presented with metastatic seminoma, ... [3] Of the 81 patients treated at the University of Indiana for late relapse of germ cell tumours, 60% showed late relapse more than five years after primary therapy and complete remission [3] A ... 1984, the patient’s histopathology revealed a mixed tumour, a choriocarcinoma and an embryonic carcinoma, with retroperitoneal and pulmonary metastases To treat this, an orchiectomy was performed,...

Ngày tải lên: 11/08/2014, 14:20

4 294 0
báo cáo khoa học:" Reliability and validity of a single item measure of quality of life scale for adult patients with cystic fibrosis" pot

báo cáo khoa học:" Reliability and validity of a single item measure of quality of life scale for adult patients with cystic fibrosis" pot

... scale measure and body image may suggest that adult patients with CF may have adopted a level of negative image (stigma) of the disease in manner that is different from an adaptation to physical ... feasibility of administration the testretest reliability and the validity of a single- item global quality of life scale We also examined the relationship of the single item global quality of ... quality of life scale: ‘this must be balanced against the practicality of ascertaining such information Brevity may come at a cost of detail.’ [16] Clinical implication We believe that the single...

Ngày tải lên: 11/08/2014, 23:22

8 208 0
w