rebel and king in a time of transition

... period financial andsocial accounting have increasingly merged – as the ability to collect and analyse people’s data is aimed at and judged according to the samefiscal values of maximising their ... providing real-time feedback about users’ actions by amassinglarge quantities of data and then simplifying this data into modes that easily understandable, such as progress bars, graphs and charts’ ... capitalism and capitalists are increasingly viewed and lamented as inherently unaccountable? Why, forinstance, isn’t the enhanced use of data collection and analysis being directed at making markets less...

Ngày tải lên: 14/03/2022, 15:33

... that weaves behavioral science and data analytics into games that reveal a jobcandidate’s potential on a number of metrics For example, in Dashi Dash, Knack’ssignature game, candidates are asked ... airlines,pharmaceutical companies, global retailers, and start-ups large and small Digitally savvyand forward thinking, he was by all appearances a winner—a member of the top 4 or 5percent flying high in ... manufacturing”; a disillusioned twenty-something accountant in Manhattan; a father of three in Charlotte, North Carolina,passionate about his job at a convenience store chain; a Cleveland-based...

Ngày tải lên: 20/01/2020, 11:31

... that weaves behavioral science and data analytics into games that reveal a jobcandidate’s potential on a number of metrics For example, in Dashi Dash, Knack’ssignature game, candidates are asked ... airlines,pharmaceutical companies, global retailers, and start-ups large and small Digitally savvyand forward thinking, he was by all appearances a winner—a member of the top 4 or 5percent flying high in ... manufacturing”; a disillusioned twenty-something accountant in Manhattan; a father of three in Charlotte, North Carolina,passionate about his job at a convenience store chain; a Cleveland-based...

Ngày tải lên: 03/03/2020, 10:50

... sovividly in the central squares of Madrid and Lisbon in 2011, were the clearexpression of frustration and anger with a political and economic class that hadled Spain and Portugal to the brink of political ... Park inManhattan to Gezi Park in Istanbul On the other hand, the Internet and the newsocial media have provided an invaluable tool for connecting and mobilisingyoung people to become active in ... online, and new technologies provided main arena forthe sharing of information and the mobilisation (through social networks) ofparticipants (Anduiza et al 2013) However, the occupation of real-world...

Ngày tải lên: 17/10/2022, 22:20

... PhD., Rafael Costa, Ieda and Antônio, Letícia, Conceição, Ascenção, Maria Esther, Maria Lucia, Alex, Diana, Rafael and Silvana I thank also all the family Poullet and my friends I thank Delfi na, ... privacy theory and the capability approach and between privacy and virtu-ality?” and in Chap 6 with “What challenges does A m I bring to data protection law and what does the theoretical approach ... there are investments in “human and social capital”, traditional and modern communication infrastructure, wise management of natural resources and participatory governance (Caragliu et al 2009...

Ngày tải lên: 14/05/2018, 15:36

... their exploits in Abyssinia in the campaign againstMussolini’s Italian East Africa, and a lot of new names of places, such as Addis Ababa,Eritrea, Mogadishu, Italian and British Somaliland, entered ... However,bits and pieces, gleaned from whispers, hints, and occasional anecdotes, graduallycoalesced into a narrative of his life and his side of the family.My paternal grandfather was originally a Maasai ... Stalin, Churchill, and Roosevelt—and places —America, Germany, Italy, and Russia, Japan, Madagascar, and Burma—occasionallycropped up in the story sessions at Wangarĩ’s reside These names and...

Ngày tải lên: 29/05/2018, 14:46

... how we must adapt our thinking to change, and why our brains are good at it In part II, I examine how humans (and other animals) take in information and process it so that theycan innovate to meet ... challenges of novelty and change Part III is about how the brain attacksproblems and generates new ideas and solutions, and part IV is about the barriers that can stand in theway of elastic thinking ... and makes its money by selling add-ons and upgrades Maintaining that revenuestream was another challenge In the interactive entertainment industry, a game can start out popularand still have the...

Ngày tải lên: 22/04/2019, 13:13

... UUCACCACCUUCUCCACCCAGC hsa-miR-23-3p AUCACAUUGCCAGGGAUUUCC hsa-miR-221-3p AGCUACAUUGUCUGCUGGGUUUC hsa-miR-27a-3p UUCACAGUGGCUAAGUUCCGC hsa-miR-130a-3p CAGUGCAAUGUUAAAAGGGCAU Statistical Analysis ... indicated altered levels of cytokines (leptin, adiponectin and IL-6) and decreased levels of miRNAs (320-a, 197-3p, 23-3p, 221-3p, 27a-3p and 130a3p) appear in the circulation of patients indicating ... disease states of MetS and obesity in a population of West Virginia females Our formulated biomarker and miRNA panel has significant potential for detection of MetS and attenuation of disease...

Ngày tải lên: 15/01/2020, 06:55

... use a walker Able to participate in horseback riding Ease of personal hygiene, including diapering and bathing Ease of dressing Ease of dressing and transfers extremities Increased range of motion ... categorized according to the do-mains of body function/structure, activity, and participa-tion in the Internaparticipa-tional Classificaparticipa-tion of Funcparticipa-tioning, Disability, and ... IV and V, and families In the Spasticity Clinic at McMaster Children’s Hospital, setting goals is already integrated into the clinic appointment The development and use of an inventory of goals...

Ngày tải lên: 20/02/2020, 22:40

... project design and development, data interpretation, manuscript editing and revising All authors read and approved the final manuscript. Funding The design of this study and analysis of data were supported ... (7%) patients The ma-jority of advanced stage disease had additional extranodal sites including prostate, urinary bladder, kid-ney, adrenal gland, lung, heart, and other soft tissues Pathological ... further radialoca-tion, intra-thecal prophylaxis and tumor size was constructed In the univariable cox hazard ratio model, analysis of fac-tors influencing PFS and OS of DLBCL patients is sum-marized...

Ngày tải lên: 17/06/2020, 11:18

... the data, and drafted the manuscript EO participated in the collection and assembly of data and drafted the manuscript WC analyzed and interpreted the data and drafted the manuscript All authors ... Com-passionate Cancer Care Medical Group Incorporated – Corona; Compassionate Cancer Care Medical Group Incorporated – Fountain Valley; Advanced Research Management Services, Incorporated; Kenmar ... Medical Research of South Florida, Incorporated; Columbus Clinic, PC; Clintell, Incorporated; Investigative Clinical Research, LLC; Cancer Center of Indiana; Family Medicine of Vincennes Clinical...

Ngày tải lên: 21/09/2020, 02:01

... degree of income inequality, and so on long-One drawback of this kind of diverse sample is that it creates difficulties in measuring variables in a consistent and accurate way across countries and ... and participants of a seminar at the World Bank.Trang 3A substantial literature analyzes the effects of income inequality onmacroeconomic performance, as reflected in rates of economic growth and ... insignificantly related to secondary and higherattainment of females and to primary attainment of males and females.) Growth is inversely related to the fertility rate, measured as the number of prospective...

Ngày tải lên: 13/01/2021, 12:31

... It's Billy Graham and Johnny Walker It's blues and jazz, gospel and rock It's cotillions and snake-handling It's Aunt Jemima and Martha White It's Antoine's and the Varsity It's grits and etouffee ... descriptive and explanatory work to make a difference? Would we Trang 8be judged as relevant and essential in an increasingly competitive and discerning public arena? As a professional group, we are largely ... stories of Margaret Mitchell and Maya Angelou It's Booker T Washington and Tuskegee University It's Shannon Faulkner and the Citadel It's Emory University and Abraham Baldwin Agricultural College...

Ngày tải lên: 21/10/2022, 17:34

... plans was created in 1997 and then revised in 2002 The devastating physical and economic damage the CAC sustained as a result of Hurricane Katrina in 2005 necessitated the creation of a Strategic ... Changes Trang 151 Recognition in National Market The CAC presents a large breadth of contemporary art, showcasing works from local and regional artists as well as national and international artists ... Trang 32Chapter 6: ConclusionThe CAC finds itself in a period of great transition, and as with any major transition, there are accompanying changes within the organization that affect staff and...

Ngày tải lên: 24/10/2022, 02:40

... people and subsequently We can also find the story of Ken Arok in another chronicle Nagarakrtagama See Slametmuljana, Nagarakretagama dan Tafsir Sejarahnya (Jakarta: Bhratara Karya Aksara, 1979) ... the last king of Singasari, King Kartanegara Claiming dynastic continuity with the Singasari Kingdom, Wijaya partially took the official name of its founder Ken Arok or Sang Rajasa Sang Amurwabhumi ... Meanwhile, Nagarakrtagama song XL/5 tells of one Ranggah Rajasa who was enshrined at Kagenengan as god Shiwa and at Usana as Buddha upon his death in 1227 See Slametmuljana, A Story of Majapahit, p...

Ngày tải lên: 16/09/2015, 17:14

... activities Make mental health services available, including Employee Assistance Program, if applicable Practice active listening and acknowledge pain and anxiety as well as a healing process that has ... of the students, families and staff? ● Provide regular information updates and maintain open communication with teachers, other staff and parents? ● Monitor rumors and maintain timely, accurate ... respectful and hopeful ● Make a list of all key agencies and determine communications channels Agencies include: • NEA, state and local teacher associations • Local, state and federal law enforcement as...

Ngày tải lên: 14/03/2014, 20:20

... that that bargain could be maintained by entirely virtual hearings It may be hard to maintain the seriousness of litigation and the trial process unless court hearings take place in a physical ... on It is inconceivable that a technologically advanced and savvy society will not in ten years be capable of filing and serving all claims via the internet It is equally inconceivable that we should ... finances mean that it is particularly important to bear in mind fundamental principles, because they must always be upheld In facing present challenges and in approaching the future, the starting...

Ngày tải lên: 31/03/2014, 03:20

... decided in the United Kingdom, Australia, and Canada in order to show that law provides a moral resource that can inform a rule -of- law project capable of responding to situations which place legal and ... because of the central place taken by an international and domestic discourse of human rights in our thinking about law Indeed, the relationship between international law and domestic law is a ... part of a more general task of escaping from an authoritarian past and in their regard it makes complete sense to talk about a choice to have the rule of law In contrast, in societies that are...

Ngày tải lên: 07/03/2014, 02:20

... further in that chapter, picking up a theme first sounded in Chapter 4, that mining the vast amount of personal information stored in public and private computer databases is a critical weapon against ... grave and increasing danger, comparable to what the nation faced at the outset of World War II The insights from that research, combined with my longstanding interest and (as a judge) activity in ... Little, and I agree with those who argue that our vigorous campaign against al-Qaeda and our extensive if chaotic efforts at improving homeland security have bought us a breathing space against...

Ngày tải lên: 10/06/2014, 23:24

... hsp70 as part of an immunization regimen that apparently evokes a wider breadth of neutralization [43]; and the use of AAV as a vector to carry an antibody-producing gene into the cells of a vaccinee ... that are highly efficacious They are almost always needed for inactivated vaccines, e.g tetanus, diphtheria, and polysaccharide conjugates (exceptions are hepatitis A and hepatitis B), and are often ... oral vaccination and following with parenteral boost Moreover, it is not impossible to consider mixed intranasal and intrarectal administration to immunize both the genital and gastrointestinal...

Ngày tải lên: 20/06/2014, 08:20