raubal geli c 1908 1931 german niece of adolf hitler

Lập trình hướng đối tượng C/C++ - OOP 02 basic concepts of object

Lập trình hướng đối tượng C/C++ - OOP 02 basic concepts of object

... c u tr c tr c C cc s d ng: ng: Khai báo l p (file h): t o ki u cho đ i tư ng ng class p> { ; tính>; ; c> ; }; C i đ t l p (file cpp): c i ... Nguy n Minh Huy 13 T mv c Dr Guru khuyên: khuyên: Quy t c h p đen: đen: Thu c tính c t m v c private đ h n ch truy xu t t Phương th c có t m v c public đ cung c p tính năng class PhanSo { private: ... ng l p Đ i tư ng gì? gì? Chương trình c máy” ph c t p máy” p C u thành t nhi u lo i “chi ti t” t” Chi ti t b n: hàm, c u tr c n: hàm, tr c Đã đ t o chương trình t t? t? Chi ti t m i: Đ i tư ng!!...

Ngày tải lên: 12/01/2014, 16:56

22 541 5
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

... study The lectin is unique from that of other sialic acidspeci c lectins O-Acetyl sialic acid-speci c lectin was Ó FEBS 2003 A sialic acid speci c lectin from P jacquemontii (Eur J Biochem 270) ... mL fractions collected on ice in polypropylene tubes containing 100 lL of 100 mM CaCl2 at a rate of 0.3 mLÆmin)1 The presence of calcium chloride was required in the collected fractions because ... affinity of the humoral agglutinin BSM contains the sialic acids, N-acetylneuraminic acid, N-glycolylneuraminic acid, N-acetyl 9-O-acetylneuraminic acid and, 8,9-di-O-acetylneuraminic acid [6]...

Ngày tải lên: 21/02/2014, 00:20

8 617 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

... sites I of res as direct repeats, instead of two full res gd102NLS is also proficient to recombine sites I in the absence of accessory sites The efficiency of this reaction is significantly reduced, ... recombination in cell line TRE2/3 which contains a single copy of the vector The analysis was performed in the absence of doxycyclin, i.e the TRE-CMV promoter is active and transcription proceeds ... Micrococcal nuclease digestion of nuclei reveals extended nucleosome ladders having anomalous DNA lengths for chromatin assembled on non-replicating plasmids in transfected cells Nucleic Acids...

Ngày tải lên: 22/02/2014, 07:20

7 474 0
Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx

Báo cáo khoa học: Mapping of the 45M1 epitope to the C-terminal cysteine-rich part of the human MUC5AC mucin potx

... the MUC5AC sequence With use of the primer pair 5¢-TATTCTAGAG AAGAGGGCCT GGTGTGCCGG AACCAGGACC AGCAGGGACC CTTCAAG-3¢ (GH262) and 5¢-ACGCGCTAGC TCAATGATGA TGATGATGGT GCATGGGGGA CACTGGGACG CC-3¢ ... a cDNA clone corresponding to the 3¢-end of human MUC5AC inserted into a pBluescript vector, was used as a template for PCR With use of the primer pair 5¢-GCTTCTAGAC ACGAGAAGAC AACCC ACTCC C- 3¢ ... part of the figure Dimer, dimeric M-MUC5AC-CH; Monomer, monomeric M-MUC5AC-CH; M-5AC-CH, reduced M-MUC5AC-CH; C2 -H, C- terminal cleavage fragment; M -C1 , N-terminal cleavage fragment The position of...

Ngày tải lên: 07/03/2014, 05:20

9 331 0
Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt

Báo cáo Y học: Human immunoglobulin A (IgA)-specific ligands from combinatorial engineering of protein A ppt

... insertion of a linker sequence formed by the oligonucleotides ZlibHisStop-1: 5¢-TCGACCCATCAT CATCATCATCATTAATAAGTCGAC-3¢ and ZlibHisStop-2: 5¢-TCGACGTCGACTTATTAATGATGATGA TGATGATGATGGG-3¢ encoding ... reference surface (ABD) was used to produce subtractive sensorgrams IgA-speci c affibody ligands (Eur J Biochem 269) 2649 Construction and production of dimeric (head-to-tail) affibody constructs The ... therapeutic use are currently under investigation in clinical trials [34] The majority of those are of IgG isotype, which can effectively activate complement- and antibodydependent cellular cytotoxicity...

Ngày tải lên: 08/03/2014, 23:20

9 585 0
BÁO CÁO CÔNG TY CỔ PHẦN XÚC XÍCH GERMAN potx

BÁO CÁO CÔNG TY CỔ PHẦN XÚC XÍCH GERMAN potx

... lượng c ng vi c khả ph c vụ khách hàng c Lương thưởng Chính sách lương Bổng của chúng xây dựng nhằm m c đích thu hút trì tài xuất s c cho c ng ty, tương lai C c chính sách lương bổng của chúng ... TÀI CHÍNH 17 C NG TY C PHẦN XU C XÍCH GERMAN 17 BÁO CÁO C NG TY C ̉ PHẦN XU C XÍCH GERMAN March 14, 2013 I I THÔNG TIN C BẢN − Tên c ng ty: C ng ty C phần Xu c xích ... dùng cho th c phẩm (chịu nhiệt) 14 BÁO CÁO C NG TY C ̉ PHẦN XU C XÍCH GERMAN March 14, 2013 Phân phối  a) C c nhà phân phối German là: Thịt heo C ng ty TNHH Thương mại Đ c Vinh chuyên cung c p...

Ngày tải lên: 10/03/2014, 04:20

18 272 0
Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt

Báo cáo khoa học: Arginine-induced conformational change in the c-ring ⁄a-subunit interface of ATP synthase ppt

... aI22 3C ⁄ cV5 8C aI22 3C ⁄ cL5 9C aN23 0C ⁄ cS6 6C aN23 0C ⁄ cT6 7C aN23 0C ⁄ cG6 8C aN23 0C ⁄ cI6 9C aN23 0C ⁄ cY7 0C aA23 3C ⁄ cI6 9C aA23 3C ⁄ cY7 0C aI23 7C ⁄ cV7 3C aG23 9C ⁄ cL7 6C aG23 9C ⁄ cI7 7C aL24 0C ⁄ cL7 6C ... aA23 3C ⁄ cI6 9C aA23 3C ⁄ cY7 0C aI23 7C ⁄ cV7 3C aG23 9C ⁄ cL7 6C aG23 9C ⁄ cI7 7C aL24 0C ⁄ cL7 6C aL24 0C ⁄ cI7 7C aL24 1C ⁄ cL7 6C aL24 1C ⁄ cI7 7C aL20 7C ⁄ cF5 4C aL20 7C ⁄ cI5 5C aN21 4C ⁄ cA6 2C aN21 4C ⁄ cI6 3C aN21 4C ... cI6 3C aN21 4C ⁄ cP6 4C aN21 4C ⁄ cM6 5C aN21 4C ⁄ cI6 6C aA21 7C ⁄ cM6 5C aA21 7C ⁄ cI6 6C aI22 1C ⁄ cG6 9C aI22 3C ⁄ cL7 2C aI22 3C ⁄ cY7 3C aL22 4C ⁄ cL7 2C aL22 4C ⁄ cY7 3C aI22 5C ⁄ cL7 2C aI22 5C ⁄ cY7 3C ++++ +++...

Ngày tải lên: 16/03/2014, 06:20

14 593 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... residue of Rha at the branching point Elucidation of the structure of the O-speci c polysaccharide by NMR spectroscopy The 1 3C NMR spectra of OPS-I and OPS-II were essentially identical, and ... O-polysaccharide from Citrobacter braakii O6 (Eur J Biochem 270) 2735 Fig Part of a two-dimensional 1H,1 3C HSQC spectrum of the O-speci c polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional ... OPS of Citrobacter (Fig 3) One, from Citrobacter PCM 1487 and PCM 1528 (O5), is built up of branched trisaccharide repeating units, in which D-ara4dHex is attached as a sidechain to a GlcNAc residue...

Ngày tải lên: 23/03/2014, 17:22

7 480 0
Animesh Ranjan 5101045 C-2 (biotechnology) Jaypee Institute of Information Technology pptx

Animesh Ranjan 5101045 C-2 (biotechnology) Jaypee Institute of Information Technology pptx

... academic as well as practical exposure and we look forward to more of such visits in future to enhance both our theoretical, technical and practical knowledge Alcoholic Beverages An alcoholic ... The consumption of alcohol is often important at social events in such societies and may be an important aspect of a community's culture The concentration of alcohol in a drink may be specified ... Danish scientist Hansen Nowadays there are two main varieties of yeasts that are used in brewing: saccharomyces cerevisiae and saccharomyces carlsbergensis (bottomfermenting) Certain other products...

Ngày tải lên: 24/03/2014, 04:20

20 323 0
egbers c., pfister g. (eds.) physics of rotating fluids

egbers c., pfister g. (eds.) physics of rotating fluids

... include the C+ and C coalescence points and quartic bifurcation points which can occur at certain singularities of the system (32) Extended systems for these singularities may be found in Cliffe ... of experience guarantee authors the best possible service To reach the goal of rapid publication at a low price the technique of photographic reproduction from a camera-ready manuscript was chosen ... should check the contributions for the correct use of language At Springer-Verlag only the prefaces will be checked by a copy-editor for language and style Grave linguistic or technical shortcomings...

Ngày tải lên: 24/04/2014, 16:47

445 777 0
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... II 100 150 cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain II a g u u c 200 gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT 283 B Background1 Background2 Background3...

Ngày tải lên: 18/06/2014, 18:20

12 356 0
báo cáo hóa học:" Assessment of Chronic Illness Care with the German version of the ACIC in different primary care settings in Switzerland" pptx

báo cáo hóa học:" Assessment of Chronic Illness Care with the German version of the ACIC in different primary care settings in Switzerland" pptx

... Assessment of Chronic Illness Care (ACIC) The ACIC is based on the specific interventions and concepts within the CCM It consists of 28 items covering the six areas of the CCM: Organization of the ... The German assessment of Chronic Illness Care: GACIC The German version consist of 28 items covering the six areas of the Chronic Care Model plus in congruence with the actual version 3.5 of the ... Nelson CC, King DK: Use of the Patient Assessment of Chronic Illness Care (PACIC) with diabetic patients: relationship to patient characteristics, receipt of care, and selfmanagement Diabetes Care...

Ngày tải lên: 20/06/2014, 15:20

5 312 0
Designation: C 25 – 99 - Chemical Analysis of Limestone, Quicklime, and Hydrated Lime1 pptx

Designation: C 25 – 99 - Chemical Analysis of Limestone, Quicklime, and Hydrated Lime1 pptx

... concentrations are intended: Acetic acid (HC2H3O2) Hydrochloric acid (HCl) Hydrofluoric acid (HF) Nitric acid (HNO3) Perchloric acid (HClO4) Phosphoric acid (H3PO4) Sulfuric acid (H2SO4) Ammonium hydroxide ... be calculated 30.2 Summary of Test Method—Determine the percent of free water, LOI, CO2, SO3, CaO, and MgO in accordance with the preceding sections Calculate combined H2O, calcium carbonate, calcium ... introduction of traces of organic matter due to the action of the hot sulfuric acid on the paper; these would consume KMnO4 and give high results for CaO 17.5 Calculation—Calculate the percentage of CaO...

Ngày tải lên: 10/07/2014, 23:20

36 700 1
Designation: C 109/C 109M – 99 - Compressive Strength of Hydraulic Cement Mortars (Using 2-in. or [50-mm] Cube Specimens)1 pps

Designation: C 109/C 109M – 99 - Compressive Strength of Hydraulic Cement Mortars (Using 2-in. or [50-mm] Cube Specimens)1 pps

... curvature, grind the face or faces to plane surfaces or discard the specimen A periodic check of the cross-sectional area of the specimens should be made NOTE 7—Specimen Faces—Results much lower than ... specimens in water at a temperature of 73.56 3.5°F or [23 2 C] and of sufficient depth to completely immerse each specimen until time of testing 10.6.2 Wipe each specimen to a surface-dry condition, ... head of the machine The center of the sphere shall lie at the center of the surface of the block in contact with the specimen The block shall be closely held in its spherical seat, but shall be...

Ngày tải lên: 10/07/2014, 23:20

6 487 2
Designation: C 110 – 00 - Physical Testing of Quicklime, Hydrated Lime, and Limestone1 doc

Designation: C 110 – 00 - Physical Testing of Quicklime, Hydrated Lime, and Limestone1 doc

... Mixing of Mortars—Mix the mortar in accordance with the procedure for mixing pastes in Practice C 305 13.3.3 Determination of Flow—Determine the flow in accordance with the Procedure section of Test ... 20 C; variations from this temperature produce inaccuracy in the hydrometer reading; (2) Speci c gravity: Addition of dispersant changes the speci c gravity of the solution; (3) Meniscus correction: ... method covers the determination of the speci c gravity of hydrated lime The speci c gravity of hydrated lime is needed for calculations of air content (see Section 13) and Blaine Surface Area 21 Commercially...

Ngày tải lên: 10/07/2014, 23:20

19 440 0
Designation: C 114 – 00 - Chemical Analysis of Hydraulic Cement1 pot

Designation: C 114 – 00 - Chemical Analysis of Hydraulic Cement1 pot

... it through a cheap desiccant, such as calcium chloride or sulfuric acid, followed by a desiccant of high efficiency, such as magnesium perchlorate or anhydrous calcium sulfate, with care taken ... If desired calculate the percentage of CaO corrected for SrO as follows: CaOc % CaOi % 0.54 SrO % (5) where: CaOc CaO corrected for SrO, and CaOi initial CaO as determined in 13.4.1 CaO 56.08 ... Reagent Chemicals, American Chemical Society Specifications, American Chemical Society, Washington, DC For suggestions on the testing of reagents not listed by the American Chemical Society, see...

Ngày tải lên: 10/07/2014, 23:20

30 877 1
Designation: C 151 – 00 - Autoclave Expansion of Portland Cement1 pptx

Designation: C 151 – 00 - Autoclave Expansion of Portland Cement1 pptx

... sufficient water to give a paste of normal consistency in accordance with the procedure described in Test Method C 187 Mix this batch in accordance with the procedure described in Practice C 305 ... humidity of the moist storage facilities to the requirements of Specification C 511 Preparation of Test Specimens 9.1 Mixing Cement Paste—Prepare the standard batch consisting of 650 g of cement ... C 151 requirements of Practice C 490 except that molds need not be sealed humidity of the molding room within the limits of Practice C 490 5.2 Moist Storage Facilities—Maintain...

Ngày tải lên: 10/07/2014, 23:20

3 283 0
Designation: C 185 – 01 - Air Content of Hydraulic Cement Mortar1 ppsx

Designation: C 185 – 01 - Air Content of Hydraulic Cement Mortar1 ppsx

... Specification C 1005 Evaluate the weighing device for precision and accuracy at a total load of kg 5.6 Glass Graduates—Glass graduates of 250-mL capacity, conforming to the requirements of Specifications ... Standard Sand 7.1 Use sand conforming to the requirements of Specification C 778 for 20–30 sand Sampling 8.1 Sample the cement in accordance with Practice C 183 Procedure 9.1 Batch—Proportion the standard ... the mortar in accordance with Practice C 305 9.3 Flow Determination—Carefully wipe dry the flow-table top and place the flow mold at the center of it Using the spoon, place a layer of mortar about...

Ngày tải lên: 10/07/2014, 23:20

3 318 0
w