... WAVES AT BOUNDARIES AND IN DISPERSIVE MEDIA We now recognize that energy may be transmitted across the boundary surface at z into region by providing a wave moving in the z direction in that ... coefficient and find Ex1 in terms of the incident field Ex1 À À Knowing Ex1 and Ex1 , we then find Hy1 and Hy1 In region 2, Ex2 is found from (10), and this then determines Hy2 h Example ... varies as j sin zj | e-Text Main Menu | Textbook Table of Contents | 395 ENGINEERING ELECTROMAGNETICS Using the same fields investigated in the previous section, we combine the incident and reflected...
Ngày tải lên: 07/08/2014, 20:23
... jams and waste production and improper handling of life and many other issues, and create a new situation of innovation and development of green logistics global economic integration publicity and ... born in Shandong province in 1982 She is a PhD student now She is studying at Harbin University of science and technology, majoring in management science and Engineering She is research in green ... logistics infrastructure and make them macro-coordination and functional integration strengthen z Expand the investment scale of the transport infrastructure, and increase the construction intensity...
Ngày tải lên: 28/05/2016, 12:11
Vital Assets - Federal Investment in Research and Development at the Nation’s Universities and Colleges potx
... eligible institutions in the states and compared it with the institutions that actually obtained such funds in FY 2002 Not surprisingly, every MD-granting institution in every state sought and obtained ... to expand our summary presentation of information on the federal R&D funding going to higher education institutions that was presented in Discovery and Innovation: Federal Research and Development ... prosperity, national security, and other national goals The system that supports such innovation consists of a complex network of institutions that conduct research and development (R&D) in a range...
Ngày tải lên: 15/03/2014, 22:20
báo cáo khoa học: " Characterization and structural analysis of wild type and a non-abscission mutant at the development funiculus (Def) locus in Pisum sativum L" pdf
... AZ development in young pea seed at stage 8.1 and (B) In mature pea seed at 2.1 (C) Higher magnification of the AZ development in the young pea seed in (A) (D) Higher magnification of the AZ in ... loss in marginal growing regions has stimulated the evaluation of a mutation at the def locus into breeding programmes and a limited number of released varieties The spontaneous def mutation in ... (ALZ) in young and mature seeds of the def mutant in E and F, respectively (I-L) The wild type (JI 2822) (I) AZ development in the wild type pea at stage 3.1 (J) AZ development in the mature pea at...
Ngày tải lên: 12/08/2014, 03:20
the improvement of the training and development program at bitis company in vietnam
... particular since the year 2008 to now, the technical, vocational education and training in Vietnam is under the administration of the two relevant ministries namely ministry of Education and Training ... 2.5 Motivation to attend a training 2.6 Usefulness of the training 2.7 Gains acquired from the training 2.8 Applicability of training to specific job/tasks 2.9 Manager’s role in the training process ... process 2.10 Influencing factors in the training process 2.11 Commitment to attend trainings 2.12 Suggestions to improved the training process To design an improved training and development program...
Ngày tải lên: 21/08/2014, 08:14
Development of 2d and 3d BTEM for pattern recognition in higher order spectroscopic and other data arrays
... Singapore and at Bruker Biospin AG in Zurich, Switzerland I am also grateful to Dr Fethi Kooli, Dr Anette Wiesmat and many others in the Institute of Chemical and Engineering Sciences (ICES in ... planning and evaluation of sampling, experimental design and optimization, signal detection and univariate signal processing, calibration, multivariate signal processing, multivariate data analysis, ... representing a linear combination of right singular vectors which gives an estimated spectrum 119 Figure 5.4 A scheme representing a linear combination of right singular matrices which gives an estimated...
Ngày tải lên: 16/09/2015, 08:30
Motivation in learning english speaking of the second year tourism major students at tourism and foreign language department, sao do college of industry
... word “intrinsic” down to its roots, it means “innate” or “within”, thus intrinsic motivation originates in the individual itself Concerning learning it can be said that the drive or stimulation ... learning speaking? What have the teachers done to motivate their students in speaking learning? What are the factors de-motivating their students in learning speaking? What motivational strategies ... communicating with, someone for social purposes It includes both establishing and maintaining social relationships Transactional speech involves communicating to get something done, including the...
Ngày tải lên: 07/11/2012, 15:01
Warm – up activities in teaching and learning English at grade 10A5 in Cai Be high schoo
... proficient at English or not is very important to them Being proficient at English means student is good at both received skills - reading and listening, and productive skills - speaking and writing ... prepared the main components of your lesson, and made sure it is learning-rich, varied and interesting, you may find you still need some extra ingredients to make it into a smooth, integrated unit ... recreation activities, can be used to attract patients' attention and to sustain their interaction Very simple games played in a small group may serve to encourage participation by making the patient...
Ngày tải lên: 11/04/2013, 09:43
Globalization and its effects on the development of educational service in Vietnam
... Education in Vietnam and FDI 2.4.3 Education in Vietnam and migration Chapter III: Strategy for developing education services in Vietnam in globalization 3.1 Increasing the impact of education ... The growing internationalisation of business education can help the spread of best practice techniques and internationally recognised standards in business education International education providers ... Vocational training/education This includes skills training, particularly on-thejob training • Tertiary education This includes domestic higher education institutes • Foreign education This includes...
Ngày tải lên: 23/04/2013, 11:16
Evaluation of employees’ job satisfaction and role of gender difference an empirical study at airline industry in iran
... to job satisfaction, determinants of job satisfaction, and methodology adopted Subsequently, the main findings are presented and discussed and finally conclusions and managerial implications of ... bring to an increase of responsibility and status and a better remuneration package among the individuals who are promoted” Kreitner and Kinicki (2004) mentioned that job satisfaction and the promotion ... Methodology The population of this study consists of the employees of private airline companies in Iran which called Airline1, Airline2, and Airline3 We choose only private airlines that have more than...
Ngày tải lên: 11/09/2013, 11:44
A discourse analysis of english speeches delivered by guest speakers at graduation ceremonies in US colleges and universities
... can clarify and justify a certain feature and characteristic Thirdly, inductive and reductive methods are inevitable In summary, together with the combination of qualitative and quantitative approaches, ... (formally) begins the imperatives and followed by a verb in the plain form with the meaning: I propose that you and I something In negative form, “not” is put after “Let’s” to propose that you and I ... features of layout and thus help the teachers a lot in giving students some tips in writing a graduation speech well and persuasively Moreover, the findings are also of great help in teaching...
Ngày tải lên: 26/11/2013, 13:27
Tài liệu Accelerating Reproductive and Child Health Program Development: The Navrongo Initiative in Ghana docx
... African ministers of health, the Bamako Initiative sought to translate the social institutions that organize African daily life into resources for organizing, financing, and sustaining community ... quality, and administrative control that are integrated into traditional institutions of village governance Establishing these mechanisms involves six milestones in organizational change that are ... demonstrates affordable and sustainable means of attaining the ICPD agenda and Millennium Development Goals with existing technologies Accumulating and using research results was crucial to building...
Ngày tải lên: 13/02/2014, 16:20
Tài liệu Báo cáo khoa học: Epidermal growth factor receptor in relation to tumor development: EGFR gene and cancer ppt
... homology in the C-terminal regulatory domain are relatively low, being 33, 24 and 28%, respectively regulin and epigen); (b) those that bind to EGFR and ERBB4 (including betacellulin, heparin-binding ... ligand-binding domain; a transmembrane domain; an intracellular tyrosine kinase domain; and a C-terminal regulatory domain [2] The extracellular domain is subdivided further into four domains ... is also intriguing that EGFR mutations in the tyrosine kinase domain are almost exclusively seen in lung cancers and not in other types of tumor It is of particular interest that EGFR mutations...
Ngày tải lên: 16/02/2014, 09:20
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... roles in mediating intersubunit interactions within a ring Alternatively, the RDF and TRP sequences may modulate the functions of the SRH and the ATP-binding pocket, respectively This may, in turn, ... ability to interact with a panel of known Vps4p interactors indicating that the N-terminal domain is correctly folded in each of the mutant proteins and that the b domain is correctly folded in the...
Ngày tải lên: 07/03/2014, 05:20
history and development of higher education in india 1 5 ppt
Ngày tải lên: 09/03/2014, 17:20
corporate social responsibility strategies for sustainable development for small and medium enterprises in the village of bac ninh province, vietnam
... enterprises in Bac Ninh trade villages during integration The analysising of current and dynamics situations in production and business development of small and medium enterprises in the villages during ... Activities held in Vietnam in ASEAN, AFTA, WTO, globalization trends, international integration, the region, facilitate the mobilization of investment capital, expanding links, international co-production ... population and labor Labour structure in 2008 in Bac Ninh province has 56,683 employees in small and medium enterprises 36 In North and security in 2009 is 1024.3 thousand people Population increases,...
Ngày tải lên: 13/03/2014, 14:20
Food Advertising and Marketing Directed at Children and Adolescents in the US pot
... marketing method for reaching children and adolescents and include cross-selling, tie-ins, premiums, and sweepstakes prizes Cross-selling and tie-ins combine promotional efforts to sell a product In ... Milk Chocolate Weights and Measures M&M's® The M&M's Brand Chocolate Candies Counting Board Book; The M&M's Brand Counting Book; More M&M's Brand Chocolate Candies Math; The M&M's Brand Count ... the growing influx of inschool marketing and advertising and have advocated limiting commercial activities in schools, arguing that children's health is not an acceptable "trade off" for increased...
Ngày tải lên: 15/03/2014, 22:20
Báo cáo Y học: Rum1, an inhibitor of cyclin-dependent kinase in fission yeast, is negatively regulated by mitogen-activated protein kinase-mediated phosphorylation at Ser and Thr residues pptx
... histone H1 mediated by Cdc2 kinase in an in vitro kinase assay These data indicate that the catalytic domain of p25rum1 is located in its C-terminal portion and deletion of 74 N-terminal amino acids ... investigators concluded that periodic accumulation and phosphorylation-initiated ubiquitinationation of p25rum1 in G1 phase play a role in setting a threshold of cyclin levels important in determining ... proteins as a Cdc2 kinase inhibitor (Fig 3B) Therefore, the data indicate that N-terminal phosphorylation of p25rum1 indeed reduces the Cdc2 kinase inhibitor activity of this protein Determination...
Ngày tải lên: 17/03/2014, 23:20