... to sit in ………garden 37 This morning I had……….boiled egg and toast for breakfast 38 ………president of the United States is elected every four years 39 As I was walking along the street,I saw……E10 ... note on…….pavement 40 I went into the shop and asked to speak to………manager 41 “ Have you got………car?” “ No,I’ve never had…… car in my life” 42 There’s no need to buy any milk ….…milkman brings it ... Wednesday 58 What is……… highest mountain in ……… world? 59.We don’t go to ……….theatre very much these days In fact ,in … town where we live there isn’t……… theatre 60 It was a long voyage We were at……...
Ngày tải lên: 19/09/2013, 01:10
... identity as an individual can mean the difference between attracting patrons and creating fans Here are some examples to clarify this concept: Self magazine has readers; Oprah Winfrey’s magazine is ... become a music-marketing consultant for independent bands after years of playing in bands, interviewing musicians, circulating in the music business, and actively marketing my own interests I had the ... follow their true calling can usually trace their skills and talents back to childhood For instance, my fascination with music, writing, and art started when I was in early grade school What interests...
Ngày tải lên: 28/06/2014, 12:20
Bài tập thực hành với A/AN và THE(phần 4) doc
... room sanitation is usually a good indication of how clean other areas are a a b an c the d no article is needed 16 Finally, before you sign _ agreement to join, read the contract carefully a a ... believe are _ advantages and disadvantages there a a b an c the d no article is needed 14 Look in _ locker room, workout room, and shower–everywhere should be clean a a b an c the d no article is ... end up choosing _ wrong club and losing more money than pounds a a b an c the d no article is needed You may find out too late that _ health clubs aren’t for you a a b an c the d no article is...
Ngày tải lên: 12/07/2014, 05:21
Cách dùng mạo từ a, an và the pptx
... Ontario A the B × C a D an The explorer crossed .Pacific Ocean in a canoe A an B a C the D no article She has been playing flute for ten years A an B a C the D × For breakfast we usually have ... noticed that Spanish eat a lot of vegetables A an B a C the D × 13 A volcano has erupted in .Philippines recently A an B a C the D many 14 examinations always make him nervous A an B a C the D ... and toast A an B a C the D × What time you start work in the morning? A an B a C the D × Barbara hopes to go to university next year A an B a C the D × They went on a cruise down Nile and...
Ngày tải lên: 13/08/2014, 06:20
A, AN, ONE, THE (With Keys)
... a; -: a, - ,a 12-, an, an; - 13 a, a; a; a, a 14-, an 15 A, a; a; a, a 16 an, a; -, an, -, a, a 17 a, -; a, 18- ,a 19 a; a, - 20 a, a; a; - 21 A; a, an; a 22- ,a, an, a 23- ,a, an 24 a, -; a 25 a: a, a 26 a, ... normally the preferred answer.) a, the; a, a an, the, the a, the, -,- the, a, the, -.-. (the) a, - ,the, a a, a/ the, an, the a, -, an, the, the, the, the a, the, the a, a 10 the, the, the, the, an 11- (the) , ... a; a: a A, a a, a, an a, a/ the, a/ your one; a; an a, a One, a (a) , a, a; a; One 10 a; One 11 a/ the; a, a/ the; - 12 a, a, one 13 one; one; a 14 a; a, a 15 a, one, a, a, a 16 a, a; one 17 One, a, ...
Ngày tải lên: 29/10/2014, 11:00
articles a an and the eg40
... before it – e.g an adjective or an intensifier – the article goes before the first modifier: “It was a great party.” “My grandma had a really lovely day.” For more fun tests, quizzes and games ... use a / an to show that somebody or something is part of a group: “Louise is a teacher.” “Brian is a crossword addict.” “My car is an old blue Vauxhall Corsa.” • If the thing has one or more ... www.englishbanana.com now! English Banana.com Test Your Grammar Skills When to Use Articles – a / an & the • Uncountable nouns don’t need an article in front of them: “Would you like wine with your meal,...
Ngày tải lên: 20/08/2015, 08:25
A an và the
... (Jonh không khoẻ Anh ta bác sĩ.) (bác sĩ riêng anh ta) Sau số thí dụ khác: • There was a man talking to a woman outside my house The man look English I think the woman was foreign (Bên nhà có người ... vệ sinh nhà này) • The postman was late this morning.(=our usual postman) 2/4 A/ An The (Sáng người đ a thư đến trễ) (người đ a thư thường chúng tôi) • I took a taxi to the station.(= the station ... va ăn nhà hàng.) • I saw a film last night The film was about a solider and a beautiful girl The solider was in love with the girl but the girl was in love with a teacher So the solider shot the...
Ngày tải lên: 14/01/2016, 15:31
On the conformation of DNA confined in a nanochannel or absorbed at an interface
... Jeroen van kan for providing stamps, without which nothing could be done and Ms Zhang Fang, for helping me with the nano-fabrication work at the early stage I also thank Mr Teo and Mr Michael of the ... towards understanding the physical and chemical phenomena that are important in the condensation of DNA In this thesis, we seek to uncover the behavior of single stranded and double stranded DNA ... phase diagram Chapter Literature Review 10 2.1 Material for Biological Research For the investigation of the conformation of DNA, a range of materials are used These materials include mica and...
Ngày tải lên: 14/09/2015, 14:01
A study of the issues of teaching listening setions in tiếng anh 11 at high schools in nghe an
... teaching in Tieng Anh 11 Finally, class observations are very important to examine the current teaching context in each listening lesson The data was tape-recorded and transcripted 3.6 DATA ANALYSIS ... that in communicative language teaching, language is a system for the expression of meaning The learners are negotiators and integrators whereas the teachers role is just a facilitator of the ... English teaching plays an important role in the period of modernization and industrialization For the educational innovation, many considerable changes in teaching and learning English at high...
Ngày tải lên: 14/12/2013, 00:41
A study on the use of language activities to enhance 11th grade student's speaking skill in pham hong thai school, hung nguyen district, nghe an province
... Definition of the language activities Language activities are activities that are used in teaching a language for teachers aims In speaking class, language activities are often exerted because the ... create contexts in which the language is useful and meaningful The learners want to take part and in order to so they must understand what others are saying or have written, and they must speak ... happening in the world, so they have an intrinsic educational value Language change is reflected in the materials so that students and teachers can keep abreast of such changes Reading texts are...
Ngày tải lên: 18/12/2013, 10:03
Tài liệu THE CHICAGO WOMEN’S HEALTH RISK STUDY RISK OF SERIOUS INJURY OR DEATH IN INTIMATE VIOLENCE A COLLABORATIVE RESEARCH PROJECT doc
... This analysis also included several sub-analyses, separate high-risk profiles for African/American/Black, Latina/Hispanic, and white or other women; and a separate profile for pregnant women In addition, ... three racial/ethnic groups (African/American/Black, Latina/Hispanic and white or other), and second to explore their relationship case-by-case in more qualitative analysis The second goal was made ... the clinic and hospital sample became women who had been physically abused by an intimate partner, man or woman, in the past year The lethal sample became any intimate partner death in 1995 or...
Ngày tải lên: 12/02/2014, 23:20
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC ... RPE6 5a- His-Fwd NA TGCARRAAYATHTTYTCCAG AYRAAYTCRWRBCCYTTCCA GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT ... RPE65c in the retina and its subcellular fractionation To analyze the cellular localization of zebrafish RPE65c in the retina, we generated an antibody using a specific zebrafish RPE65c peptide, and the...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf
... essential for binding the ion and also for the rotational mechanism of the ring The c ring of I tartaricus has 11 negative charges that are equally distributed along the horizontal axis of the rotor ... by silver staining (lane 6) or immunoblotting using an antibody against subunit c1 (lanes and 8) or subunit c2 ⁄ (lane 9) The antibody against c2 ⁄ also reacts with c1 2000 FEBS Journal 275 (2008) ... essential negative charge (glutamate or aspartate) in transmembrane helix four as part of the ion-binding site Therefore, the c ring of A woodii has only 10 membrane-buried negative charges that are essential...
Ngày tải lên: 18/02/2014, 17:20