protein kinase c inhibitory phenylpropanoid glycosides from polygonum species

... hepatocytes with ATP or PLC was speci c for certain molecular species, diacyl, alkylacyl and alk-1-enylacyl subclasses were separated and their molecular species composition was determined by combined ... Diacylglycerol molecular species composition of rat hepatocytes cultured for 48 h Diacylglycerols were analysed as diacylglycerobenzoate derivates by combined HPLC/MS Individual molecular species ... combined HPLC/ MS The results in Table show a typical molecular species composition of the diacylglycerol subclass from untreated hepatocytes; the corresponding HPLC trace is shown in Fig 4A Control...

Ngày tải lên: 20/02/2014, 02:21

... kB-dependent mechanism J Immunol 161, 6206– 6214 31 Chen, C. -C. , Chiu, K.-T., Sun, Y.-T & Chen, W. -C (1999) Role of the cyclic AMP -protein kinase a pathway in lipopolysaccharideinduced nitric oxide ... LPS/IFN Effects of protein kinase inhibitors on the enhancement by TS of LPS/IFN-induced NO production Protein kinases such as PKA and PKC, and various factors such as tumor necrosis factor receptor ... induced by LPS/IFN (Fig 2B), as well as NO production Accordingly, we concluded that the enhancing effect of TS on LPS/IFN-induced NO production is caused by enhancement of iNOS protein induction...

Ngày tải lên: 22/02/2014, 04:20

... (pBSMARCKS 52 nt) was constructed by annealing the two synthetic oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; ... transfection with a chimeric luciferase-MARCKS construct and for transient transfection with the cDNAs coding for human HuD and HuR The mouse embryonic carcinoma cell line PCC7-Mz1 is a subclone ... c- myc (pc-myc), cytochrome c oxidase (pTH82) and the control vector pBluescript (KS+) (pBS), were hybridized with 32P-labeled run-off transcripts from nuclei isolated from confluent Swiss 3T3 cultures...

Ngày tải lên: 08/03/2014, 08:20

... were detected using the enhanced chemiluminescence kit according to the manufacturer’s instructions Confocal immunofluorescence microscopy U87 cells grown on poly(L-lysine)-coated glass coverslips ... translocation Incubation with EGCG for 10 significantly increased the amount of PLC -c1 associated with the membrane fraction in U87 cells (Fig 5A) Using confocal immunofluorescence microscopy, we confirmed ... the PLC -c1 [Ins(1,4,5)P3–Ca2+]–Ca2+/calmodulin-dependent protein kinase II (CaM kinase II)–PLD pathway and the PLC -c1 (diacylglycerol)–PKC–PLD pathway Experimental procedures PLD assay PLD activity...

Ngày tải lên: 16/03/2014, 16:20

... calcium-activated K+ channel, large-conductance Ca2+and voltage-regulated K+ channel, hyperpolarizationactivated cyclic nucleotide gated channel, ether-a-go-go and cyclic nucleotide-gated channel ... recombinant calcium-dependent protein kinase (DcCPK1) from carrot (Daucus carota L.) Biochim Biophys Acta 1434, 6–17 Uozumi N, Gassmann W, Cao Y & Schroeder JI (1995) Identification of strong modifications ... during stomatal closure, may occur via protein kinases which have PKClike characteristics, such as CDPKs Phospholipid signaling may be involved in the preceding signaling cascades 2324 Materials...

Ngày tải lên: 22/03/2014, 21:21

... cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa; PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa PKCe #1, PKCe #2 and PKC siRNAs ... are from Clontech (Mountain View, CA, USA) siRNA sequences are: ZIP8 #1, accuaaagca uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; ... Quantification of cadmium accumulation in cells (A) Comparison of intracellular cadmium accumulation from medium containing lM CdCl2 between control cells (Ø) and 100 ngÆmL)1 PMA-treated cells...

Ngày tải lên: 23/03/2014, 06:20

... translocation takes place we subjected the cells to immunocytochemical analysis and confocal microscopy PKCa (Fig 2) and PKCe (Fig 3) were detected predominantly in the cytoplasm of untreated cells; ... the amyloid precursor protein Mol Psychiatry 6, 520–528 Slack, B.E (2000) The m3 muscarinic acetylcholine receptor is coupled to mitogen-activated protein kinase via protein kinase C and epidermal ... the kinase to speci c intracellular compartments Inactive cytosolic-resident protein kinases may be recruited to perform distinct functions based on the localization signals that they have received,...

Ngày tải lên: 23/03/2014, 13:20

... amplification (cycle profile: 94 C/ 5 min; 10 × 94 C/ 15 sec, 56 C/ 30 sec, 72 C/ 2 min; 15 × 94 C/ 15 sec, 56 C/ 30 sec, 72 C/ 2 min, plus cycle elongation of 20 sec for each cycle; 72 C/ 7 min), a rat PKCδ ... oligonucleotide primers are used: 5′-AAA GGA TCC CAT ATG GCA CCG TTC CTG CGC-3′ as the 5′-primer and 5′-TCT GGG AAT TCA CTA CTA TTC CAG GAA TTG CTC-3′ as the 3′-primer For polymerase chain reaction ... of each vector can be recovered by conventional plasmid isolation techniques from bacterial culture Successful recombination efficiency seems Expression and Purification of PKC from Insect Cells...

Ngày tải lên: 11/04/2014, 10:12

... resistance in NSCLC patients [24] Consistent with this, COX-2 expression has been detected immunohistochemically in NSCLC specimens, including all squamous cell lung cancer and 70% of adenocarcinomas ... NSCLC cells that accompany changes in COX-2 by treating cells directly with COX-2 protein Because this is the first such study, there was no available information on the concentrations of COX-2 ... and A431 cells (C) Red curve indicated cells treatment with COX-2, black curve indicated with COX-2 and AH6809, green curve indicated with COX-2 and KT5720, and blue curve indicated with COX-2 and...

Ngày tải lên: 10/08/2014, 10:20

... radical nephrectomy or partial resection Of the 128 RCC samples, 10 were papillary RCC, 10 were chromophobe RCC, and 108 were clear cell RCC according to the 2002 AJCC/UICC classification The clear ... & Clinical Cancer Research 2011, 30:88 http://www.jeccr.com/content/30/1/88 crucial for survival of clear cell RCC cells and may serve as a therapeutic target of RCC Methods Samples We collected ... expression Cell culture Five human RCC cell lines 769P, 786-O, OS-RC-2, SN1 2C, and SKRC39 were used in this research Clear cell RCC cell lines 769P and 786-O were purchased from the American Type Culture...

Ngày tải lên: 10/08/2014, 10:21

... platelets [10], protein kinase C (PKC) negatively regulates PLC Diacylglycerol (DAG) and Ca2+, both downstream products of PLC, activate PKC, which in turn, completes a negative feedback loop by inhibiting ... before activation, on the rate and magnitude of Ca2+ influx Radiometric assessment of Ca2+ fluxes 45Ca2+ (Calcium-45 chloride, specific activity 18.53 mCi.mg-1, Perkin Elmer Life Sciences, Inc.) ... are compatible with a mechanism whereby PKC negatively modulates the activity of PLC, attenuating IP3 production and promoting the clearance of cytosolic Ca2+, with associated decreased production...

Ngày tải lên: 11/08/2014, 08:22

... inhibition of cell cycle progression and expression of cell-specific functions are the characteristics of cell differentiation PKCα is known to upregulate some proteins which affect cyclin and cyclin-dependent ... stearic acid and palmitic acid are the most common saturated fatty acids254 The most common unsaturated fatty acid is oleic acid Arachidonic acid can be synthesized from linoleic acid which is ... junctions are specific cell-to-cell junctions that can connect the cytoplasms of adjacent cells via water-filled channels 1.1.2 Cell signaling machinery 1.1.2.1 Receptors of the signals The receptors...

Ngày tải lên: 12/09/2015, 21:10

... o C CaM CaMK cAMP cDNA CDK CL CO COS cPKC C1 Degree Celcius Calmodulin Calmodulin Kinase Adenosine 3’, 5’- cyclic monophosphate complimentary deoxyribonucleic acid Cyclin-dependent kinases Cardiolipin ... hydrophobic motif are critical for the catalytic competence and function of Protein Kinase C α”, Journal of Biological Chemistry, 2006 Oct 13;281(41): 30768-81 xiii Summary Protein Kinase C- related kinases ... Abbreviations α Alpha ACC Anti-parallel coiled coil ADAM A Disintegrin And Metalloprotease AGC family Protein Kinase A, Protein Kinase G and Protein Kinase C aPKC Atyptical Protein Kinase C Arg Arginine...

Ngày tải lên: 14/09/2015, 12:01

... IFN-b, 5’CAGCTCCAAGAAAGGACGAAC-3’ and 5’-GGCAGTGTAACTCTTCTGCAT-3’; b-actin, 59-AGATGACCCAGATCATGTTTGAGA-39 and 59-CACAGCCTGGATGGCTACGTA-39 Wild type C5 7BL/6 mice were obtained from the BRC, and ... TLR7/9-stimulated CDC To further confirm that PKCm is critical for TLR7/9-induced IFN-b production, we knockdown PKCm expression in primary CDC using siRNA technology Purified CDC were harvested on day of culture ... granulocyte-macrophage colony-stimulating factor-transduced X-63 cells After to days of culture, CDC were purified using anti-CD1 1c monoclonal antibody-coupled magnetic beads (Miltenyl Biotech)...

Ngày tải lên: 23/09/2015, 14:47

... carcinoma and rectal carcinoma as compared to normal colonic tissue Colon carcinoma cells, rectal carcinoma cells and their normal healthy tissue counterparts were harvested (1a, carcinoma cells; 4a, ... anti-PARP (Cell Signal) The ProteoExtract Subcellular Proteome Extraction Kit (Calbiochem, La Jolla, CA, USA) was used to extract proteins from mammalian cells according to their cytosolic or cytoskeletal ... predisposition to chronic lymphocytic leukemia and the majority of cases of sporadic chronic lymphocytic leukemia [6], suggesting an important role of DAPK-1 in altering the incidence of certain cancer types...

Ngày tải lên: 18/02/2014, 17:20

... CC62 (5¢-GTGTTGCGG TGAATGTGCTCAAGAGCG-3¢) and two reverse primers, CC61 (5¢-CTGCCCGGTGGGGGTGATCAAGA TG-3¢), CC63 (5¢-CGCTCTTGAGCACATTCACCGCA ACAC-3¢), were synthesized Base mismatches (underlined ... and Taq DNA polymerases; Roche Molecular Biochemicals) was used for this purpose The forward (CC7: 5¢-CATATGAGCCCC CGAGTTGG-3¢) and reverse (CC8: 5¢-TCATTGCGCTA TCTCGTATCGG-3¢) primers were designed ... template Primary reactions were carried out with primers CC58/CC63 and CC61/CC62, while for secondary reactions, PCR primers CC58 and CC61 were used Thus, the K42N mutation was contained within...

Ngày tải lên: 22/02/2014, 04:20

... (sense: 5¢-CGGTGTG AACGGATTTGGCCGTAT-3¢, antisense: 5¢-AGCCTTC TCCATGGTGGTGAAGAC-3¢); c- fos (sense: 5¢-GAATA AGATGGCTGCAGCCAAGTGC-3¢, antisense: 5¢-AAG GAAGACGTGTAAGCAGTGCAGC-3¢), and c- myc (sense: ... 5¢-AAGTTGGACAGTGGCAGGGT-3¢, antisense: 5¢-TTGCTCCTCTGCTTGGACAG-3¢) Amplification was conducted over 35 cycles using a three-step program as described previously [28] Samples were analyzed by electrophoresis ... purchased from Sigma-Aldrich Silica G thin layer chromatography plates were from Whatman Phospho-speci c antibodies (Elk1, PRK1/2) were obtained from Cell Signaling Technology Smooth muscle cell...

Ngày tải lên: 17/03/2014, 09:20

... AAGAACCCCAG-3¢) was located at nucleotides 63–90 of the coding sequence, and the antisense primer (5¢-TG CTGAATTCCCTCCCTCCTGCACTAGTCAG-3¢) overlapped the stop codon DNA sequencing confirmed the restored ... particulate fractions as described [21] Sarco/endoplasmic reticulum Ca2+ATPase (SERCA 2), an integral protein of the endoplasmic reticulum [22], calreticulin, a protein of the endoplasmic reticulum ... (HIP9 and HIP4 clones), and in two clones of Chang cells stably transfected with the empty vector as controls (PC4 and PC8 clones) Protein kinase activity assayed with kemptide, a speci c substrate...

Ngày tải lên: 23/03/2014, 13:20

... ¨ 16 ⁄ 60 column (GE Healthcare) connected to Akta FPLC (GE Healthcare) Expression and purification of recombinant AMPK a2b 2c3 in COS7 cells COS7 cells were cotransfected with cDNAs encoding mouse ... 5¢-AMP activates the AMP-activated protein kinase cascade, and Ca2+ ⁄ calmodulin activates the calmodulin-dependent protein kinase I cascade, via three independent mechanisms J Biol Chem 270, ... Carlson M & Carling D (2005) Ca2+ ⁄ calmodulin-dependent protein kinase kinase-beta acts upstream of AMP-activated protein kinase in mammalian cells Cell Metab 2, 21–33 Momcilovic M, Hong SP & Carlson...

Ngày tải lên: 30/03/2014, 08:20

... ni nwohs saw NAE fo esruoc lacinilc ehT NAE fo noitavresbo lacinilC stluseR )napaJ ,supmylO( epocsorcim lacofnoc resal 005VF na htiw denimaxe erew snemiceps deniats -ecnecseroulfonummi elbuod ehT ... deilppa saw noitcaer LENUT eht dna KNJ-p htob rof gniniats ,sevren citaics detceffa-NAE ni sllec yrotammalfni mµ 03 = srab elacs eht ,C- A nI sevren citaics eht ni )neerg( sllec nnawhcS evitisop 001S ... yrevocer eht gnirud sisotpopa yb ylralucitrap ,segahporcam evitisop-1DE gnidulcni ,sllec yrotammalfni fo htaed llec ot dael hcihw ,NAE htiw evren citaics eht ni sllec yrotammalfni fo noitavitca...

Ngày tải lên: 07/08/2014, 18:21