Ngày tải lên: 11/08/2014, 20:20
Cambridge.University.Press.Press.Politics.and.the.Public.Sphere.in.Europe.and.North.America.1760-1820.Jul.2002.pdf
... from the scrutiny of this new rational-critical public. This being the case, the opinion of the public increasingly assumed the role of a legitimis- ing tribunal which judged the acts of political ... Ryan, Civic Wars: Democracy and Public Life in the American City During the Nineteenth Century (Berkeley, CA, ). See for example Charles E. Clark, The Public Prints: The Newspaper in Anglo- American ... codification and cataloguing of information and new processes of data collection. Whereas continual copying of manuscripts in scribal culture led to the cumulative corruption of texts, print culture...
Ngày tải lên: 21/09/2012, 10:58
Báo cáo y học: "Use of chinese and western over-the-counter medications in Hong Kong"
... traditional Chinese medicine in Hong Kong Special Administrative Region, China. J Altern Complement Med 2007, 13(3):361-7. 9. Licensing of Chinese Medicines Traders, Chinese Medicine Council of Hong ... The Chinese University of Hong Kong, Shatin, Hong Kong, China. Authors’ contributions VCHC, CHL and SMG conceived the research idea. CHL conducted the statistical analysis. VCHC interpreted the ... with Chinese medicine practitioners A total of 19.0% of the population used Chinese OTC medications only whereas 7.2% used both Chinese medi- cine consultation and Chinese OTC medication in the previous...
Ngày tải lên: 25/10/2012, 10:06
Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"
... positioning light was centered at the level of the sinus, indicating the optimized center of the re- construction area. In addition, the head position was adjusted in such a way that the hard ... 17-19]. Occasionally, one or both sinuses may be absent. The prominence of supercilliary arcs does not indicate the absence, presence or size of the frontal sinus [3]. The objective of this ... facial bones [8]. The exact drainage system of the frontal sinus depends on its embryologic development [2,13]. The drainage usually occurs directly into the frontal recess [14] or into the...
Ngày tải lên: 25/10/2012, 11:04
Báo cáo y học: "Transporter Molecules influence the Gene Expression in HeLa Cells"
... different concentra- tions of TPs showed an influence on the behaviour of the cells, which may alter the biochemical effect of the transported cargo and which could consequently in- fluence the interpretation ... tgaccttgatttattttgcatacc Right 218-237 20 55 cgagcaagacgttcagtcct HMBS NM_001024382.1 Left 580-597 18 61 tgtggtgggaaccagctc Right 653-671 19 47 tgttgaggtttccccgaat Int. J. Med. Sci. ... 480-499 20 55 gcaaacagagtgagcccttc Right 551-569 19 58 ggccagccacataggagtt ALAS NM_000688.4 Left 1867-1889 23 43 catgagacagatgctaatggatg Right 1936-1955 20 45 ttttagcagcatctgcaacc Hprt1 NM_000194.1...
Ngày tải lên: 03/11/2012, 11:44
Báo cáo y học: "An innovative method to evaluate the suture compliance in sealing the surgical wound lip"
... maintaining the wound-margin coales- cence during the first 24-72 hrs following operation, thus complying with the remodeling of the wound volume resulting from the clearance of edema in the ... poor Abdominal, thoracic, subcutane- ous, intestinal, vascular, pediatric, plastic, oncology, orthopedic PANACRYL: glycolide and lactide copolymer coated by caprolactone and glycolide braided ... water-proof property across the sutured line. The clinical pilot study using epidermal hydrocolloid thin layer coating was found to be very effective in detecting the proper tension of each knot. This...
Ngày tải lên: 03/11/2012, 11:52
Tiểu luận tiếng anh : Robinson Crusoe – A Representative of the English Bourgeoisie in the early 18th century
... and working in such factories. England became a typical example of initial accumulation of capitalism. Holding power in economics, the English bourgeoisie further encroached on the politic field. ... field. They became the driving force in the English society. After actually overthrowing the feudalism and establishing the Institutional Monarch system, they led the country to the capitalist ... PART C: CONCLUSION “ Robinson Crusoe” is the most famous and successful novel of Daniel Defoe. The charm of this story mainly lies in its intense reality, in the succession of thought, feelings...
Ngày tải lên: 26/11/2012, 12:02
John Wiley and Sons - The Portable MBA in Project Management
... become synonymous for project scheduling tech- niques. (Both PERT and CPM were much more than scheduling techniques, but the scheduling graphics they produced, called PERT charts and Critical ... product management, including Winning at New Products: Accelerating the Process from Idea to Launch, which has sold over 100,000 copies. He is president and cofounder of The Product Development Institute, ... However, these factors are merely proof that this discipline is becoming a necessary skill in most organizations. The root cause of the growing use of project management is the increasing rate of change...
Ngày tải lên: 07/02/2013, 09:32
TYPHOONS AND TECHNICAL SOLUTIONS RECOMMENDED FOR EXISTING AND NEW HOUSES IN THE CYCLONIC REGIONS IN VIETNAM
... also considered in this map. During recent 20 years, some research were conducted with objectives to provide the guidelines for construction (including planning) in the cyclonic and flooding ... the information about the typhoons in Vietnam and the technical solutions recommended for existing and new houses in the tropical cyclonic areas considering the local conditions. Houses in the ... remain significant. The coastline in this region is in the Northwest- Southeast direction, which coincides with the path of the cyclonic flows. Therefore, many typhoons after hitting the region...
Ngày tải lên: 01/04/2013, 22:47
A Contrastive Analysis between the Verb ‘Run’ in English and the Verb ‘Chạy’ in Vietnamese
... thiệu cuốn sách c a một nhà báo tên tuổi c c i tên rất ấn tượng là Chạy. Theo cuốn sách đó, bây giờ ở ta, chả c c i gì là không phải chạy: Chạy ch c, chạy quyền, chạy bằng, chạy tuổi, chạy c ... function, to the manner in which they are acquired by children, to the psychological mechanisms that underlie the production and reception of speech, to the literary and the aesthetic or communicative ... take into account the constraints that include context, the rules of grammar of the two languages, their writing conventions, and their idioms. Therefore, there exists a common misconception...
Ngày tải lên: 06/04/2013, 08:43
A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI by Dinh Huu Son
... establishes Internet channels can choose to introduce new products or services to customers. Not only in the Internet channel a direct connection to customers or to any participant in the value chain, ... to work each day for a company that produces a product, that is yet another link in the chain of commerce. When you think about commerce in these different ways, you instinctively recognize several ... switching theory in July 1961 and the first book on the subject in 1964. Kleinrock convinced Roberts of the theoretical feasibility of communications using packets rather than circuits, which was a...
Ngày tải lên: 07/04/2013, 23:51