... 5'-AGGGCGGGGGCATCGGGCACCGGGATGGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated ... (5'gatttcgcgcaggtgatgag-3') for UL8; and 18S rRNA-f (5'-actcaacacgggaaacctca-3') and 18S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18S rRNA Reactions were performed using SYBER Premix Ex Taq II (Takara) with ... Real-time PCR amplifications were performed with primers UL6-f (5'-aaattctgtgtcaccgcaacaac-3') and UL6-r (5'-gcccgaagcactgactcaa-3') for UL6; UL8-f (5'-cttgctggacgcagagcacta-3') and UL8-r (5'gatttcgcgcaggtgatgag-3')...
Ngày tải lên: 20/06/2014, 01:20
... 23 of American Mathematical Society, Colloquium Publications, o American Mathematical Society, Providence, RI, USA, 4th edition, 1975 13 P Nevai, T Erd´ lyi, and A P Magnus, “Generalized Jacobi ... functions, and Jacobi e polynomials,” SIAM Journal on Mathematical Analysis, vol 25, no 2, pp 602–614, 1994 14 A Iserles, P E Koch, S P Nørsett, and J M Sanz-Serna, “On polynomials orthogonal with ... Soardi, A Cohen type inequality for ultraspherical series,” Archiv der Mathematik, vol 38, no 3, pp 243–247, 1982 22 Journal of Inequalities and Applications B Dreseler and P M Soardi, A Cohen-type...
Ngày tải lên: 21/06/2014, 07:20
Engineering Concepts in Industrial Product Design With A Case Study of Bicycle Design
... kullanılan tasarım metotları ve bunların tasarım aktivitesi sürecindeki avantajları da konunun daha net bir şekilde a ıklanabilmesi amacı ile belirlenmiştir Bu çalışma, tasarım sistemleri alanının ... doğrultuda, endüstri ürünleri tasarımı alanının bazı mühendislik alanları ile birlikte, tasarım problemlerine ve araçlarına yaklaşımlarının karşılaştırılması gösterilmiştir Ayrıca, mühendislikte kullanılan ... methods are stated and their advantages in design activity are revealed This study is a part of design systems area, with formal approaches to models of design processes and knowledge Finally, a case...
Ngày tải lên: 02/07/2014, 13:08
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx
... of a three-stranded antiparallel b-sheet and an a- helix, packed approximately parallel to the b-sheet, with the seven thoroughly conserved amino acids (Arg6, Arg8, Trp10, Glu16, Arg18, Arg26 and ... performed as described previously [9] Selection of the DNA-binding site A 60 bp single-stranded DNA RDM10, with 10 randomized oligonucleotides in the center, i.e CTGTCAGTGAT GCATATGAACGAATN10AATCAACGACATTAGGATC ... China (grant no 2007AA10Z110) References Okamuro JK, Caster B, Villarroel R, Van Montagu M & Jofuku KD (1997) The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis...
Ngày tải lên: 18/02/2014, 13:20
Supporting Finite Element Analysis with a Relational Database Backend docx
... specifically calls for a particular field mapped onto a particular geometry, the data for that mapping may not even explicitly reside in a database table That is, many physical or mechanical measures ... data sources and data access must be self-describing, aid self-configuring applications, and accommodate relational, image, and XML data The system can only use standard off-the-shelf hardware ... visualization tools and database systems can work very well to support both the actual FEA simulation workflow and data management and for the post-production data analysis tasks The tools have...
Ngày tải lên: 30/03/2014, 22:20
finite element simulation and analysis of local stress concentration in polymers with a nonlinear viscoelastic constitutive model
Ngày tải lên: 29/11/2014, 07:00
Drawing - Fun With A Pencil
... can trace a photo, and draw from the tracing, or take any of your own drawings and distort them Here again is a chance for your own invention Draw a square around your subject Divide each way ... Nevertheless, we can take as a basic form a ball sliced off at the sides, leaving it a little wider one way than the other, and adding to it or taking some away The forehead may be flattened, cut ... make any allowance for the variety of shapes 36 After this book was published, I learned with interest that a similar basic head form has been used for years by Miss E Grace Hanks of the Pratt...
Ngày tải lên: 13/09/2012, 14:19
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"
... investigated, and the operation will be planned with as little trauma as possible, in order to preserve the hard and soft surrounding structures Clinical case A 30 years old Caucasian patient came ... patient reported localized pain and a slight homolateral submandibular lymphadenopathy, without functional limitations or fever No occlusal hindrance was caused by these supernumerary teeth Although ... investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission of the algic...
Ngày tải lên: 25/10/2012, 11:40
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
... bupivacaine with or without Sarapin Group II = bupivacaine and steroids with or without Sarapin WC = Workers compensation MVA = Motor vehicle injury Analysis of Data Numbers Analyzed Data were analyzed ... C-fibres Acta Anaesthesiol Scand 1990; 34: 335-8 69 Pasqualucci A, Varrassi G, Braschi A, et al Epidural local anesthetic plus corticosteroid for the treatment of cervical brachial radicular pain: ... 20: 539-45 Schwarzer AC, Wang SC, Bogduk N, et al Prevalence and clinical features of lumbar zygapophysial joint pain: A study in an Australian population with chronic low back pain Ann Rheum Dis...
Ngày tải lên: 26/10/2012, 09:07
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment of ... Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral sclerosis...
Ngày tải lên: 03/11/2012, 10:52
What To Do If Trapped In A Lift With A Dentist
... consciousness? Watched the telly? Had an argument? Made a sandwich? Started a war? If we're a species apart then why we behave like animals? Because we are animals we're monkeys with delusions In anthropocentric ... relaxation CD that appears to be voiced by Ian Paisley A pair of trainers pickled in bree A vague sense of inadequacy A perambulating hamster nailed to the knee of a disgruntled member of a select ... are bad enough anyway but don't use white ones Afterwards, all the adults were stuffing their faces with food and drink, and laughing and joking I was really puzzled and angry “Hang on,” I wanted...
Ngày tải lên: 14/11/2012, 16:50
Approaches to Establish a Modeling WWTP with a Case Study in Qinghe WWTP
... important to achieve the entire functions of operation control and administration In some WWTPs, wastewater analytical apparatuses and data transferring equipments are collocated sufficiently with ... conductance etc., and water quality analysis apparatus such as NH4+-N, PO43—P and COD etc The instruments should be maintained regularly, cleaned on time and calibrated periodically, to guarantee ... WWTPs have their own data management systems, such as SCADA (Supervisor, Control and Data Acquisition) and control system with the function to pick up the analysis data and control the automatic...
Ngày tải lên: 05/09/2013, 09:08
A kinetic study of resorcinol-enhanced hydroxyl radical generation during ozonation with a power law type equation
... that combined a rapid data acquisition system with an ESR spectrometer (RE-1X, JEOL, Tokyo, Japan) and a stopped-flow system (Ohtsuka Electric Co Ltd., Osaka, Japan) The OH radicals trapped with ... REFERENCES Andreozzi R., Caprio V., Insola A and Marotta R (1999) Advanced oxidation processes (AOP) for water purification and recovery Catal Today, 52, 51-59 Bader H and Hoigne J (1981) Determination ... radical generation 1.5-fold that of phenol itself Power law type rate equations are usually adopted to correlate the experimental data in laboratory-scale and pilot-plant scale reactors, and even...
Ngày tải lên: 05/09/2013, 09:38
Reporting with a Windows Service
... adding the dataset or data table, please refer to Chapter for a walkthrough Step 2: Designing the Report Layout All right, we have our dataset in place with its data table and all the necessary columns ... Value Complaint Type ComplaintID Value =Fields!ComplaintID.Value CreateDate Value =Fields!CreateDate.Value CreateDate Format d CreateDate TextAlign Left CustomerName Value =Fields!CustomerName.Value ... selecting Add ® DataTable Click the header of the newly created data table, and name it dtComplaintList Start adding columns to dtComplaintList by right-clicking the data table and selecting Add ®...
Ngày tải lên: 05/10/2013, 08:48
Reporting with a Console Application.
... the key to our data, it is important to design the data table to match the data types returned from the database Let’s add a new data table to dsVendorPO The data table will have all the columns ... textbox3 Value Last Name textbox10 Value E-mail Address CustomerID Value =Fields!CustomerID.Value FirstName Value =Fields!FirstName.Value LastName Value =Fields!LastName.Value EmailAddress Value =Fields!EmailAddress.Value ... =Fields!PurchaseOrderID.Value OrderDate Value =Fields!OrderDate.Value SubTotal Value =Fields!SubTotal.Value TaxAmt Value =Fields!TaxAmt.Value Freight Value =Fields!TotalDue.Value ShipMethodName Value...
Ngày tải lên: 05/10/2013, 08:48
Module 3: Manipulating XML with Transact-SQL
... xpath_namespaces (optional) XML namespace declarations that are used in row and column XPath expressions in OPENXML statements Module 3: Manipulating XML with Transact-SQL The following example ... Use XML Path Language (XPath) expressions in rowpattern and colpattern parameters to specify rowset structure Materials and Preparation This section provides the materials and preparation tasks ... can then write Transact-SQL SELECT, UPDATE, or INSERT statements that modify a database The OPENXML statement has the following syntax OPENXML(idoc, rowpattern [, flags]) [WITH (SchemaDeclaration)...
Ngày tải lên: 18/10/2013, 18:15